Biolegend, 302651, TotalSeq™-D0085 anti-human CD25 Antibody, 10μg

CD25 is a 55 kD type I transmembrane glycoprotein also known as the low affinity IL-2 receptor α chain or Tac. It is expressed on progenitor lymphocytes, activated T and B cells, and activated monocytes/macrophages. CD25 is also expressed on a subset of non-stimulated CD4 + T cells termed T regulatory cells. CD25 associates with the IL-2 receptor β (CD122) and common γ chains (CD132) to form the high affinity IL-2R complex.
10μg
Verified Reactivity: Human
Reported Reactivity: Baboon, Chimpanzee, Cynomolgus, Pigtailed Macaque, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications include: immunocytochemistry3.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. Kmieciak M, et al. 2009. J. Transl. Med. 7:89. (FC) PubMed Ernst CW, et al. 2007. Clin. Exp. Immunol. 148:271. (ICC) PubMed
RRID: AB_2892350 (BioLegend Cat. No. 302651)
Structure: Type I transmembrane glycoprotein, 55 kD
Distribution: Activated T cells and B cells, monocytes/macrophages, Treg
Function: Associates with IL-2 receptor β (CD122) and γ chains (CD132) to form high affinity IL-2R complex
Ligand/Receptor: IL-2
Cell Type: B cells, Macrophages, Monocytes, T cells, Tregs
Biology Area: Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors
Antigen References: 1. Taniguchi T, et al. 1993. Cell 73:5. 2. Waldmann T. 1991. J. Biol. Chem. 266:2681.
Gene ID: 3559
UniProt: View information about CD25 on UniProt.org
Clone: BC96
Regulatory Status: RUO
Workshop: V T-072
Other Names: Low affinity IL-2R, IL-2R α chain, Tac, p55
Isotype: Mouse IgG1, κ
Barcode Sequence: TTTGTCCTGTACGCC