Iright
BRAND / VENDOR: Biolegend

Biolegend, 304349, TotalSeq™-D0576 anti-human CD49d Antibody, 10μg

CATALOG NUMBER: 304349
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD49d is a 150 kD α integrin chain known as α 4 integrin or VLA-4 α chain. It forms a heterodimer with either integrin β1 (α 4 β 1 , VLA-4) or β7 (α 4 β 7 ). CD49d is expressed broadly on T lymphocytes, B lymphocytes, monocytes, thymocytes, eosinophils, basophils, mast cells, NK cells, dendritic cells, and some non-hematopoietic cells, but not on normal red blood cells, platelets or neutrophils. VLA-4 binds to VCAM-1 (CD106) and fibronectin. α 4 β 7 is the receptor for VCAM-1 and MAdCAM-1. CD49d participates in mononuclear cell trafficking to endothelial sites of inflammation and has roles in cell-cell interactions and cell adhesion to extracellular matrices. CD49d is involved in lymphocyte migration, T cell activation, and hematopoietic stem cell differentiation. CD49d is a marker to isolate pure populations of Treg cells due to its absence on Foxp3 + cells.
10μg
Verified Reactivity: Human, Cynomolgus, Rhesus
Reported Reactivity: African Green, Baboon, Cat, Cow, Chimpanzee, Common Marmoset, Dog, Horse, Sheep, Squirrel Monkey
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunohistochemical staining of acetone-fixed frozen tissue sections, and in vitro T cell costimulation2,3. The Ultra-LEAF™ Purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 304339 and 304340).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. Jeong SH, et al. 2004. J. Virol. 78:6995. (Costim) Vogel TU, et al. 2002. J. Immunol. 169:4511. (Costim) Kleinewietfeld M, et al. 2009. Blood 113:827. (FC) PubMed Palacious F, et al. 2010. Blood 115:4488. PubMed Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Sestak K, et al. 2007. Vet. Immunol. Immunopathol. 119:21. Mattapallil MJ, et al. 2011. J. Immunol. 187:1977. PubMed
RRID: AB_2892357 (BioLegend Cat. No. 304349)
Structure: Integrin, type I transmembrane glycoprotein, 150 kD.
Distribution: T cells, B cells, NK , dendritic cells, thymocytes, monocytes, eosinophils, mast cells.
Function: Lymphocyte migration, T cell activation, stem cell differentiation.
Ligand/Receptor: Fibronectin, VCAM-1, MAdCAM-1
Cell Type: B cells, Dendritic cells, Eosinophils, Mast cells, Monocytes, NK cells, T cells, Thymocytes, Tregs
Biology Area: Cell Adhesion, Cell Biology, Immunology, Innate Immunity
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Elices M, Ed.1995. Springer Semin. Immunopathol. 16(4). 2. Lobb RR and Helmer ME. et al. 1994. J. Clin. Invest. 94:1722.
Gene ID: 3676
UniProt: View information about CD49d on UniProt.org
Clone: 9F10
Regulatory Status: RUO
Workshop: V S215
Other Names: VLA-4 α chain, α4 integrin, Integrin α4 chain, ITGA4
Isotype: Mouse IgG1, κ
Barcode Sequence: CCATTCAACTTCCGG


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924