Product Description
CD62L is a 74-95 kD single chain type I glycoprotein referred to as L-selectin or LECAM-1. It is expressed on most peripheral blood B cells, subsets of T and NK cells, monocytes, granulocytes, and certain hematopoietic malignant cells. CD62L binds to carbohydrates present on certain glycoforms of CD34, glycam-1, and MAdCAM-1 and with a low affinity to anionic oligosaccharide sequences related to sialylated Lewis X (sLex, CD15s) through its C-type lectin domain. CD62L is important for the homing of naïve lymphocytes to high endothelial venules in peripheral lymph nodes and Peyer's patches. It also plays a role in leukocyte rolling on activated endothelial cells.
10μg
Verified Reactivity: Human
Reported Reactivity: Chimpanzee, Cow
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Concentrated supernatant from PMA-activated human peripheral blood leukocytes
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: Western blotting2,3,9 and in vitro blocking of lymphocytes binding to high endothelial venules (HEV)2. The Ultra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. Nos. 304853-304858).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Schlossman S, et al. Eds. 1995. Leucocyte Typing V. Oxford University Press. New York. Kishimoto TK, et al. 1990. Proc. Natl. Acad. Sci. USA 87:2244. (WB, Block) Jutila M, et al. 2002. J. Immunol. 169:1768. (WB) Tamassia N, et al. 2008. J. Immunol. 181:6563. (FC) PubMed Kmieciak M, et al. 2009. J. Transl. Med. 7:89. (FC) PubMed Thakral D, et al. 2008. J. Immunol. 180:7431. (FC) PubMed Charles N, et al. 2010. Nat. Med. 16:701. (FC) PubMed Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Koenig JM, et al. 1996. Pediatr. Res. 39:616. (WB) Shi C, et al. 2011. J. Immunol. 187:5293. (FC) PubMed Burges M, et al. 2013. Clin Cancer Res. 19:5675. PubMed Cash JL, et al. 2013. EMBO Rep. 14:999. (FC) PubMed
RRID: AB_2894612 (BioLegend Cat. No. 304863)
Structure: Selectin, single chain glycoprotein, 74-95 kD
Distribution: Majority of B cells, naïve T cells, subset of memory T and NK cells, monocytes, granulocytes, thymocytes
Function: Leukocyte homing, leukocyte tethering, rolling
Ligand/Receptor: CD34, GlyCAM, MAdCAM-1
Cell Type: B cells, Granulocytes, Monocytes, Neutrophils, NK cells, T cells, Thymocytes, Tregs
Biology Area: Cell Adhesion, Cell Biology, Costimulatory Molecules, Immunology, Innate Immunity
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: Kishimoto T, et al. 1990. P. Natl. Acad. Sci. USA 87:2244. Kishimoto T, et al. 1991. Blood 78:805.
Gene ID: 6402
UniProt: View information about CD62L on UniProt.org
Clone: DREG-56
Regulatory Status: RUO
Workshop: V S056
Other Names: L-selectin, LECAM-1, LAM-1, Leu-8, TQ-1
Isotype: Mouse IgG1, κ
Barcode Sequence: GTCCCTGCAACTTGA
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924