Iright
BRAND / VENDOR: Biolegend

Biolegend, 307413, TotalSeq™-D1182 anti-human CD262 (DR5, TRAIL-R2) Antibody, 10μg

CATALOG NUMBER: 307413
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

DR5 is 55 kD member 10B of the TNF receptor superfamily (TNFRSF10B), also known as TRAIL-R2, TRICK2, KILLER, and CD262. It binds the cytotoxic ligand TRAIL and induces apoptosis. The DR5 receptor is broadly expressed on a variety of normal tissues and many tumors. DR5 expression has been reported to be upregulated in human cells by interferon-α, 2-methoxyestradiol, and paclitaxel, and downregulated by adenoviral E3 proteins.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Extracellular domain of DR5-human IgG1 Fc fusion protein
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Uno K, et al. 2003. Blood 101:3658. Sato K, et al. 2005. J. Immunol. 174:4025. Lundgvist A,et al.2006.Cancer Res.14:7317.PubMed
RRID: AB_3068121 (BioLegend Cat. No. 307413)
Structure: TNFR superfamily, 55 kD
Distribution: Broadly expressed on normal and tumor cells
Function: Induces apoptosis
Ligand/Receptor: TRAIL
Biology Area: Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Immunology
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors
Antigen References: 1. MacFarlane M, et al. 1997. J. Biol. Chem. 272:25417. 2. Walczak H, et al. 1997. EMBO J. 16:5386. 3. Shigeno M, et al. 2003. Oncogene 22:1653. 4. LaVallee T, et al. 2003. Cancer Res. 63:468. 5. Nimmanapalli R, et al. 2001. Cancer Res. 61:759
Gene ID: 8795
UniProt: View information about CD262 on UniProt.org
Clone: DJR2-4 (7-8)
Regulatory Status: RUO
Workshop: HCDM listed
Other Names: TRAIL-R2, KILLER, TRICK2, TNFRSF10B, Ly98, CD262
Isotype: Mouse IgG1, κ
Barcode Sequence: TTGGCCTGTAGAAAT


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924