Product Description
CD137 is a 39 kD transmembrane protein also known as 4-1BB. It is expressed on activated T cells. CD137 is a type I membrane protein and a member of the tumor necrosis factor receptor superfamily. CD137 appears to be important for T cell proliferation and survival, and induces monocyte activation through its interaction with 4-1BB ligand.
10μg
Verified Reactivity: Human
Reported Reactivity: Chimpanzee, Baboon, Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Ectodomain of recombinant human 4-1BB fusion protein
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunoprecipitation1,4, inhibition of cytokine production2,3, and ELISA. For most successful immunofluorescent staining results, it may be important to maximize signal over background by using a relatively bright fluorochrome-antibody conjugate (Cat. No. 309804) or by using a high sensitivity, three-layer staining technique (e.g., including a biotinylated anti-mouse IgG second step (Cat. No. 405303), followed by Streptavidin-PE (Cat. No. 405204)).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Garni-Wagner B, et al. 1996. Cell. Immunol. 169:91. (IP) Salih HR, et al. 2000. J. Immunol. 165:2903. (FA) Kienzle G, et al. 2000. Int. Immunol. 12:73. (FA) Langstein J, et al. 1998. J. Immunol. 160:2488. (IP)
RRID: AB_2894598 (BioLegend Cat. No. 309845)
Structure: TNFR superfamily, type I transmembrane protein, 30 kD
Distribution: Activated T cells
Function: T cell costimulation
Ligand/Receptor: 4-1BB ligand
Cell Type: T cells
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Gruss H, et al. 1995. Blood 85:3378. 2. Sica G, et al. 2000. Adv. Exp. Med. Biol. 465:355. 3. Alderson M, et al. 1994. Eur. J. Immunol. 24:2219. 4. Schwarz H, et al. 1996. Blood 87:2839.
Gene ID: 3604
UniProt: View information about CD137 on UniProt.org
Clone: 4B4-1
Regulatory Status: RUO
Workshop: VI C-7
Other Names: 4-1BB, ILA, CD137, TNFRSF9
Isotype: Mouse IgG1, κ
Barcode Sequence: CAGTAAGTTCGGGAC
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924