Iright
BRAND / VENDOR: Biolegend

Biolegend, 310853, TotalSeq™-D0032 anti-human CD154 (CD40L) Antibody, 10μg

CATALOG NUMBER: 310853
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD154 (CD40 ligand) is also known as CD40L, gp39, TRAP and T-BAM. CD40 ligand is a 32-39 kD type II transmembrane glycoprotein. It is a member of the TNF superfamily and is expressed on activated T cells. It has been reported to be important for B cell costimulation following binding of its receptor, CD40. Additionally, binding of CD40L to CD40 on B cells promotes the secretion of immunoglobulin and Ig isotype switching. CD40L is also involved in the regulation of cytokine production by T cells.
10μg
Verified Reactivity: Human
Reported Reactivity: Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunofluorescence microscopy1,3 and blocking of T cell-dependent B cell differentiation1,2,4,5. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 310812). For highly sensitive assays, we recommend Ultra-LEAF™ purified antibody (Cat. No. 310828) with a lower endotoxin limit than standard LEAF™ purified antibodies (Endotoxin <0.01 EU/µg).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Brams P, et al. 2001. Int. Immunopharmacol. 1:277. (Block, IF) Rushworth SA, et al. 2002. Transplantation 73:635. (Block) Berner B, et al. 2000. Ann. Rheum. Dis. 59:190. (IF) Nordström T, et al. 2006. J. Leukocyte Biol. 79:319. (Block) Zhang AL, et al.2007. Blood doi:10.1182/blood-2007-02-076364. (Block) PubMed Kuchen S, et al. 2007. J. Immunol. 179:5886. Matus-Nicodermos R, et al. 2011. J. Immunol. 186:2164. PubMed Peterson VM, et al. 2017. Nat. Biotechnol. 35:936. (PG)
RRID: AB_2894564 (BioLegend Cat. No. 310853)
Structure: TNF superfamily, type II transmembrane glycoprotein, cleaved as soluble CD40L, 32-39 kD
Distribution: Activated T cells
Function: B cell costimulation
Ligand/Receptor: CD40
Cell Type: T cells, Tregs
Biology Area: Costimulatory Molecules, Immunology
Molecular Family: CD Molecules
Antigen References: 1. Najafian N, et al. 2003. Expert Opin. Biol. Ther. 3:227. 2. Racke M, et al. 2002. Expert Opin. Ther. Targets. 6:275. 3. Ford G, et al. 1999. J. Immunol. 162:4037.
Gene ID: 959
UniProt: View information about CD154 on UniProt.org
Clone: 24-31
Regulatory Status: RUO
Other Names: CD40L, gp39, TRAP, T-BAM, TNFSF5
Isotype: Mouse IgG1, κ
Barcode Sequence: GCTAGATAGATGCAA


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924