Iright
BRAND / VENDOR: Biolegend

Biolegend, 321155, TotalSeq™-D0205 anti-human CD206 (MMR) Antibody, 10μg

CATALOG NUMBER: 321155
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

Macrophage mannose receptor (MMR) is a 162-175 kD type I membrane protein also known as CD206, MRC1, or mannose receptor (MR). It is a pattern recognition receptor (PRR) that belongs to C-type lectin superfamily. MMR is expressed on macrophages, dendritic cells, and hepatic or lymphatic endothelial cells, but not on monocytes. MMR recognizes a range of microbial carbohydrates bearing mannose, fucose, or N-acetyl glucosamine. MMR mediates endocytosis and phagocytosis, induces activation of macrophages and antigen presentation, plays an important role in host defense, and provides a link between innate and adaptive immunity.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Purified human mannose receptor
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: The 15-2 antibody blocks the interaction of MMR with its ligand, and inhibits mannose receptor-mediated degradation of t-PA by macrophages. Additional reported applications of this antibody (for the relevant formats) include: Western blotting1, blocking of ligand binding1,2, immunofluorescence3, and immunohistochemical staining of acetone-fixed frozen tissue sections1. The Utra-LEAF™ purified antibody (Endotoxin < 0.01 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays (Cat. No. 321149 and 321150).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Noorman F, et al. 1997. J. Leukocyte Biol. 61:63. (WB, IHC, Block) Barrett-Bergshoeff M, et al. 1997. Thromb Haemost. 77:718. (Block) Kato M, et al. 2007. J. Immunol. 179:6052. (IF)
RRID: AB_2927868 (BioLegend Cat. No. 321155)
Structure: Type I membrane protein, Pattern Recognition Receptor (PRR) family, C-type lectin superfamily, 162-175 kD
Distribution: Macrophages, dendritic cells, hepatic and lymphatic endothelial cells
Function: Pathogen binding, facilitate phagocytosis and endocytosis, macrophage activation and antigen presentation
Ligand/Receptor: Mannose, fucose, N-acetyl glucosamine
Cell Type: Dendritic cells, Endothelial cells, Macrophages
Biology Area: Cell Biology, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family: CD Molecules
Antigen References: 1. Mason D, et al. Eds. 2002. Leukocyte Typing VII. Oxford University Press. p303 2. Wileman TE, et al. 1986. P. Natl. Acad. Sci. USA 83:2501. 3. Apostolopoulos V and McKenzie IF. 2001. Curr. Mol. Med. 1:469. 4. Le Cabec V, et al. 2005. J. Leukocyte Biol. 77:934. 5. Barrett-Bergshoeff M, et al. 1997. Thromb. Haemostatis 77:718.
Gene ID: 4360
UniProt: View information about CD206 on UniProt.org
Clone: 15-2
Regulatory Status: RUO
Other Names: MMR (macrophage mannose receptor), MR (mannose receptor), CD206, MRC1
Isotype: Mouse IgG1, κ
Barcode Sequence: TCAGAACGTCTAACT


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924