Iright
BRAND / VENDOR: Biolegend

Biolegend, 330123, TotalSeq™-D0597 anti-human CD209 (DC-SIGN) Antibody, 10μg

CATALOG NUMBER: 330123
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD209, known as Dendritic Cell-Specific Intercellular adhesion molecule 3 (ICAM-3)-Grabbing Nonintegrin (DC-SIGN), is a 44 kD type II transmembrane glycoprotein and a member of the C-type lectin family. CD209 is expressed on myeloid dendritic cells, placental macrophages, liver and placental endothelial cells. CD209 binds to ICAM-3 (CD50), ICAM-2 (CD102), and Butyrophilin (BTN2A1), and mediates dendritic cell migration and T cell proliferation. Importantly, CD209 is a receptor of HIV-1 and some other viruses (such as West Nile virus, hepatitis C virus, etc), and some bacteria or parasites. It plays a criti­cal role in capturing and internalizing those pathogens. LSP1 (leukocyte-specific protein 1) interacts with the cytoplasmic domain of CD209 and mediates transport of HIV to the proteasome.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Extracellular domain of human DC-SIGN
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunohistochemistry on frozen tissue sections1 and spatial biology (IBEX)2,3.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Granelli-Piperno A, et al. 2005. J Immunol. 175:4265. (IHC-F) Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID: AB_2904349 (BioLegend Cat. No. 330123)
Distribution: Dendritic cells
Cell Type: Dendritic cells
Biology Area: Immunology, Innate Immunity
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Granelli-Piperno A, et al. 2005. J Immunol. 175:4265.
Gene ID: 30835
UniProt: View information about CD209 on UniProt.org
Clone: 9E9A8
Regulatory Status: RUO
Other Names: Dendritic Cell-Specific Intercellular adhesion molecule 3 (ICAM-3)-Grabbing Nonintegrin
Isotype: Mouse IgG2a, κ
Barcode Sequence: TCACTGGACACTTAA


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924