Iright
BRAND / VENDOR: Biolegend

Biolegend, 333417, TotalSeq™-D0167 anti-human CD35 Antibody, 10μg

CATALOG NUMBER: 333417
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD35 is a type I single chain of glycoprotein, also known as C3b/C4b receptor, Complement Receptor type 1 or CR1. Four molecular weight allotypes (160kD, 190kD, 220kD, and 250kD) have been described. CD35 is expressed on granulocytes, monocytes, B cells, erythrocytes, and follicular dendritic cells, as well as subsets of NK and T cells. CD35 binds complement C3b, C4b, or iC3, and iC4, and plays important roles in both innate and adoptive immune response via mediating phagocytosis by granulocytes and monocytes. CD35 has also been reported to inhibit T-cell proliferation.
10μg
Verified Reactivity: Human
Reported Reactivity: African Green, Baboon, Cynomolgus, Rhesus
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: spatial biology (IBEX)4,5.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Hogg N, et al. 1984. Eur. J. Immunol. 14:236 Zabeleta J, et al. 1998. Clin Diag. Lab. Immunol. 5:690 Pascual M, et. al. 1994. Eur. J. Immunol. 24:702 Radtke AJ, et al. 2020. Proc Natl Acad Sci USA. 117:33455-33465. (SB) PubMed Radtke AJ, et al. 2022. Nat Protoc. 17:378-401. (SB) PubMed
RRID: AB_3083183 (BioLegend Cat. No. 333417)
Structure: Type I glycoprotein with four allotypes, 160kD, 190kD, 220kD, 250kD
Distribution: Granulocytes, monocytes, B cells, erythrocytes, follicular dendritic cells, subsets of NK and T cells
Function: Adhesion, mediate phagocytosis, inhibit T-cell proliferation
Ligand/Receptor: C3b, iC3, C4b, iC4
Cell Type: B cells, Dendritic cells, Erythrocytes, Granulocytes, Monocytes, NK cells, T cells
Biology Area: Cell Biology, Complement, Immunology, Neuroinflammation, Neuroscience
Molecular Family: CD Molecules
Antigen References: 1. Zola Heddy, et al. Eds. 2007. Leukocyte and Stromal Cell Molecules:The CD markers. WILEY-LISS 2. Klickstein LB, et al. 1988. J. Exp. Med. 168:1699
Gene ID: 1378
UniProt: View information about CD35 on UniProt.org
Clone: E11
Regulatory Status: RUO
Workshop: III 204
Other Names: C3b/C4b receptor, complement receptor type 1 (CR1)
Isotype: Mouse IgG1, κ
Barcode Sequence: ACTTCCGTCGATCTT


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924