Iright
BRAND / VENDOR: Biolegend

Biolegend, 334354, TotalSeq™-D0031 anti-human CD40 Antibody, 10μg

CATALOG NUMBER: 334354
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD40 is a 48 kD type I glycoprotein also known as BP50. It is a member of the TNFR superfamily primarily expressed on B cells, macrophages, follicular dendritic cells, endothelial cells, fibroblasts, and at low levels on plasma cells. CD40 has been reported to be involved in B cell differentiation, costimulation, isotype class-switching, and protection of B cells from apoptosis. Additionally, CD40 is important for T cell-B cell interactions. The ligand of CD40 is CD154 (CD40 ligand). The 5C3 antibody has been reported to promote B cell proliferation in the presence of anti-IgM, IL-4 or PMA, partially blocking CD40 binding to CD40L, and B cells rescue from apoptosis.
10μg
Verified Reactivity: Human, Cynomolgus, Rhesus
Reported Reactivity: Baboon, Chimpanzee, Squirrel Monkey
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: costimulation of B cell proliferation1, partial inhibition of CD40 binding to CD40L3, and B cell rescue from apoptosis1. The LEAF™ purified antibody (Endotoxin <0.1 EU/µg, Azide-Free, 0.2 µm filtered) is recommended for functional assays.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Schlossman SF, et al. 1995. ed. Leukocyte Typing V:White Cell Differentiation Antigens. New York:Oxford University Press. Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC) Pound JD, et al. 1999. Int. Immunol. 11:11. Shey MS, et al. 2014. J Immunol. 192:4833. PubMed Sondergaard JN, et al. 2014. Mol Immunol. 59:180. PubMed Saiki O, et al. 1995. J Clin. Invest. 2: 510-4 (Costim)
RRID: AB_2924539 (BioLegend Cat. No. 334354)
Structure: TNFR superfamily, type I glycoprotein, 48 kD
Distribution: B cells, macrophages, follicular dendritic cells, endothelial cells, fibroblasts
Function: B cell differentiation, costimulation, isotype class-switching, rescues B cells from apoptosis
Ligand/Receptor: CD154 (CD40 ligand)
Cell Type: B cells, Dendritic cells, Endothelial cells, Fibroblasts, Macrophages
Biology Area: Cell Biology, Costimulatory Molecules, Immunology, Neuroscience, Neuroscience Cell Markers
Molecular Family: CD Molecules
Antigen References: 1. Banchereau J, et al. 1994. Annu. Rev. Immunol. 12:881. 2. Foy T, et al. 1996. Annu. Rev. Immunol. 14:591.
Gene ID: 958
UniProt: View information about CD40 on UniProt.org
Clone: 5C3
Regulatory Status: RUO
Workshop: V CD40.4
Other Names: BP50, TNFRSF5
Isotype: Mouse IgG1, κ
Barcode Sequence: CTCAGATGGAGTATG


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924