Biolegend, 336237, TotalSeq™-D0407 anti-human CD36 Antibody, 10μg

CD36 is an 85 kD integral membrane glycoprotein, also known as GPIIIb, or GPIV. It is expressed on various epithelial and endothelial cells as well as erythrocytes, platelets, macrophages/monocytes and some macrophage-derived dendritic cells. CD36 functions as a scavenger receptor, binding thrombospondin, long chain fatty acids, oxidized LDL, collagen type I, IV, and V as well as apoptotic cells. The 5-271 antibody has been reported to be useful for flow cytometry.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human platelets
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG – Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunofluorescence2.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Stelner E, et al. 2006. J. Cell Sci. 119:459. Stewart DA, et al. 2012. Mol. Cancer Res. 10:727. (IF)
RRID: AB_2904359 (BioLegend Cat. No. 336237)
Structure: Integral membrane protein, CD36 family, single chain glycoprotein, 85-113 kD
Distribution: Expressed in various epithelial and endothelial cells, erythrocytes, platelets, monocytes/ macrophages, some macrophage-derived dendritic cells
Function: Scavenger receptor for thrombospondin, long chain fatty acids, anionic phospholipids, oxidized LDL, collagen types I, IV and V. Involved in recognition and phagocytosis of apoptotic cells, cell adhesion.
Ligand/Receptor: Thrombospondin, anionic phospholipids, oxidized LDL, collage types I, IV, and V
Cell Type: Dendritic cells, Endothelial cells, Epithelial cells, Erythrocytes, Macrophages, Monocytes, Platelets
Biology Area: Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
Molecular Family: CD Molecules
Antigen References: 1. Hogg N, et al. 1984. Immunology 53-753. 2. Greenwalt DE, et al. 1992. Blood 80:1105. 3. Armsesilla AL, et al.1994. J. Biol. Chem. 269:18985. 4. Endemann G, et al. 1993. J. Biol. Chem. 268:11811.
Gene ID: 948
UniProt: View information about CD36 on UniProt.org
Clone: 5-271
Regulatory Status: RUO
Other Names: gpIIIb, gpIV
Isotype: Mouse IgG2a, κ
Barcode Sequence: TTCTTTGCCTTGCCA