Product Description
CD112, known as poliovirus receptor related 2 protein (PRR2), Nectin-2, or Hve B, is a type I transmembrane glycoprotein, a member of the Ig gene superfamily. It is primarily found on myelomonocytic cells, megakaryocytes, dendritic cells, mast cells, CD34 positive stem cells, endothelial cells, epithelial cells, and neuronal cells. CD112 functions as a receptor for α-herpes viruses HSV-1 and pseudorabies virus (PRV). CD112 is an adhesion molecule involved in the formation of cell junction and regulation of NK- and T cell-mediated cytotoxicity through interaction with CD226 (DNAM-1) and other nectin family molecules.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications include: partially block CD226-Fc binding to CD112 transfectant cells and partially inhibit the cytotoxicity mediated by NK and T cells.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Tahara-Hanaoka S, et al.. 2004. Int. Immunol. 16:533 Lim O, et al. 2013. PLoS One. 8:e53611. PubMed Gillory LA, 2013. PLoS One. 8:77753. PubMed
RRID: AB_2892408 (BioLegend Cat. No. 337427)
Structure: Type I transmembrane glycoprotein, Ig superfamily
Distribution: Myelomonocytic cells, megakaryocytes, dendritic cells, mast cells, CD34-positive stem cells, endothelial cells, epithelial cells, and neuronal cells.
Function: Adhesion, receptor for some Herpes Viruses
Ligand/Receptor: CD226, CD155, Nectin-1, -3, and -4, Herpes Viruses
Cell Type: Dendritic cells, Endothelial cells, Epithelial cells, Hematopoietic stem and progenitors, Mast cells, Megakaryocytes
Biology Area: Cell Biology, Immunology, Innate Immunity, Neuroscience, Synaptic Biology
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Zola H et al. Eds. 2007. Leukocyte and Stromal Cell Molecules:The CD Markers. Wiely-Liss A John Wiley & Sons Inc, Publication 2. Bachelet I, et al. 2006. J. Bio. Chem. 281:27190 3. Pende D, et al. 2006. Blood 107:2030 4. Bottino C, et al. 2003. J. Exp. Med. 198:557
Gene ID: 5819
UniProt: View information about CD112 on UniProt.org
Clone: TX31
Regulatory Status: RUO
Other Names: Poliovirus Receptor Related 2 Protein (PRR2), Nectin-2, Hve B
Isotype: Mouse IgG1, κ
Barcode Sequence: AACCTTCCGTCTAAG
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924