Iright
BRAND / VENDOR: Biolegend

Biolegend, 345057, TotalSeq™-D0169 anti-human CD366 (Tim-3) Antibody, 10μg

CATALOG NUMBER: 345057
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD366 (Tim-3) is a transmembrane protein also known as T cell immunoglobulin and mucin domain containing protein-3. Tim-3 is expressed at high levels on activated T cells (preferentially on Th1 cells, monocytes/macrophages, and dendritic cells). Tim-3 has also been shown to exist as a soluble protein. Cells expressing Tim-3 are present at high levels in the CNS of animals at the onset of experimental autoimmune encephalomyelitis (EAE), a disease mediated by lymphocytes secreting Th1-like cytokines. Tim-3 has been proposed to inhibit Th1-mediated immune responses and promote immunological tolerance.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human Tim-3 fusion protein
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for relevant formats of this clone) include: costimulation1 (clone 2E2 has been shown to enhance T-cell receptor mediated activation and cytokine secretion) and blocking2,3.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Hastings WD, et al. 2009. Eur. J. Immunol. 39:2492. (Costim) Jones RB, et al. 2008. J. Exp. Med. 205:2763. (Block) Klibi J, et al 2009. Blood 113:1957. (FC, Block)
RRID: AB_2892421 (BioLegend Cat. No. 345057)
Structure: Transmembrane protein containing immunoglobulin domain and mucin-like domain; can exist as a soluble form lacking mucin and transmembrane domains
Distribution: Activated T cells, preferentially on Th1 cells, monocytes, dendritic cells
Function: Plays a role in regulating macrophage activation, T cell apoptosis and immune tolerance
Ligand/Receptor: Galectin-9
Cell Type: Dendritic cells, Monocytes, T cells, Th1, Tregs
Biology Area: Immunology, Inhibitory Molecules
Molecular Family: CD Molecules, Immune Checkpoint Receptors
Antigen References: 1. Hafler DA and Kuchroo V. 2008. J. Exp. Med. 205:2699. 2. Zhu C, et al. 2005. Nat. Immunol. 6:1245. 3. Wang F, et al. 2009. Immunobiology 214:342.
Gene ID: 84868
UniProt: View information about CD366 on UniProt.org
Clone: F38-2E2
Regulatory Status: RUO
Workshop: HCDM listed
Other Names: T cell immunoglobulin and mucin domain containing protein 3, hepatitis virus cellular receptor 2, CD366
Isotype: Mouse IgG1, κ
Barcode Sequence: TGTCCTACCCAACTT


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924