Biolegend, 350039, TotalSeq™-D0158 anti-human CD134 (OX40) Antibody, 10μg

CD134, also known as OX40 and TNFRSF4, is a 50 kD type I transmembrane glycoprotein. It is a member of the TNF receptor family. OX40 is expressed on activated T lymphocytes including Th1, Th2, Th17, and Treg cells. The interaction of OX40 with OX40L results in B cell proliferation and antibody secretion, regulation of primary T cell expansion, and T cell survival. OX40 influences the size of the T cell memory pool and regulation of CD4 + T cell tolerance.
10μg
Verified Reactivity: Human
Reported Reactivity: Chimpanzee
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: HTLV 1-transformed HUT 102 cells
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: Western blotting1, immunoprecipitation1, immunohistochemical staining2,3of paraffin embedded7 and frozen tissue sections, ELISA4, and functional assay5. The LEAF™ or Ultra-LEAF™ purified antibody is recommended for functional assays (contact our custom solutions team).
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Latza U, et al. 1994. Eur. J. Immunol. 24:677. (WB, IP) Durkop H, et al. 1995. Brit. J. Haematol. 91:927. (IHC) Durkop H, et al. 1997. Brit. J. Haematol. 98:863. (IHC) Willett B, et al. 2007. J. Virol. 81:9665. (ELISA) Li M and Zhang Y. et al. 2005. Cell. Mol. Immunol. 2:467. (FA) Gloviczki ML, et al. 2012. Clin. J. Am. Soc. Nephrol. 8:546. PubMed Domingos PL, et al. 2012. An. Bras. Dermatol. 87:851. (IHC)
RRID: AB_2892425 (BioLegend Cat. No. 350039)
Structure: 50 kD, TNF receptor family
Distribution: Activated T cells
Function: Receptor for OX40 ligand, co-stimulatory signal for T cell proliferation and survival.
Ligand/Receptor: OX40L (CD252)
Cell Type: T cells, Tregs
Biology Area: Apoptosis/Tumor Suppressors/Cell Death, Cell Biology, Costimulatory Molecules, Immunology
Molecular Family: CD Molecules, Immune Checkpoint Receptors
Antigen References: 1. Smith CA, et al. 1994. Cell. 76:959. 2. Chen AL, et al. 1999. Immunity. 11:689. 3. Croft M. 2010. Annu. Rev. Immunol. 28:57. 4. Withers DR, et al. 2009. J. Immunol. 183:5079. 5. Klinger M, et al. 2009. J. Immunol. 182:4581.
Gene ID: 7293
UniProt: View information about CD134 on UniProt.org
Clone: Ber-ACT35 (ACT35)
Regulatory Status: RUO
Other Names: ACT35 antigen, tumor necrosis factor receptor superfamily member 4 (TNFRSF4)
Isotype: Mouse IgG1, κ
Barcode Sequence: AACCCACCGTTGTTA