Biolegend, 350241, TotalSeq™-D0145 anti-human CD103 (Integrin αE) Antibody, 10μg

CD103 is a type I transmembrane glycoprotein also known as αE integrin, integrin αIEL chain, and human mucosal lymphocyte antigen 1. It belongs to the integrin family and is primarily found on intestinal intraepithelial lymphocytes (IEL). CD103 is also expressed on a subpopulation of lamina propria T cells, epithelial dendritic cells, lamina propria-derived dendritic cells, and a small subset of peripheral lymphocytes. Treg cells express high level of CD103. Hairy cell leukemia has also been shown to express CD103. The expression of CD103 on lymphocytes can be induced upon activation and TGF-β stimulation. In association with integrin β7, CD103 is expressed as an αE/β7 heterodimer. Mature CD103 protein can be cleaved into 2 chains, a 150 kD (C-terminal) chain and a 25 kD (N-terminal) chain, which remain linked by disulfide bonds. CD103 binds to E-cadherin and mediates homing of lymphocytes to the intestinal epithelium.
10μg
Verified Reactivity: Human
Reported Reactivity: Cynomolgus
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: HTLV-1 induced human T cell line MAPS16
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: Western Blotting1, immunoprecipitation1, and immunohistochemical staining of frozen tissue sections1.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Kruschwitz M, et al. 1991. J. Clin. Pathol. 44:636. (WB, IP, IHC-F) Yoshino N, et al. 2000. Exp. Anim. (Tokyo) 49:97. (FC)
RRID: AB_2922567 (BioLegend Cat. No. 350241)
Structure: Type I transmembrane glycoprotein, integrin family; can be cleaved into 150 kD and 25 kD chains; associated with β7 integrin
Distribution: Majority of intestinal intraepithelial lymphocytes (IEL), subpopulation of lamina propria T cells, epithelial dendritic cells, small subset of peripheral lymphocytes, Treg cells; expressed on hairy cell leukemia
Function: Retention and activation of CD103+ lymphocytes in the intestinal epithelium, regulation of tissue-specific T cell homing
Ligand/Receptor: E-Cadherin
Cell Sources: Integrin β7
Cell Targets: Integrin β7
Cell Type: Dendritic cells, Lymphocytes, T cells, Tregs
Biology Area: Cell Biology, Immunology, Neuroscience, Synaptic Biology
Molecular Family: Adhesion Molecules, CD Molecules
Antigen References: 1. Parker CM, et al. 1992. P. Natl. Acad. Sci. USA 89:1924. 2. Kruschwitz M, et al. 1991. J. Clin. Pathol. 44:636. 3. Schon MP, et al. 1999. J. Immunol. 162:6641. 4. Shaw SK, et al. 1994. J. Biol. Chem. 269:6016.
Gene ID: 3682
UniProt: View information about CD103 on UniProt.org
Clone: Ber-ACT8
Regulatory Status: RUO
Workshop: V A067
Other Names: Integrin alpha E (ITGAE)
Isotype: Mouse IgG1, κ
Barcode Sequence: GACCTCATTGTGAAT