Product Description
Human CXCR3, also known as GPR9, is a chemokine receptor that binds CXCL9, CXCL10, and CXCL11. It is a 38 kD seven-pass transmembrane receptor coupled to G-protein. CXCR3 is highly expressed by T cells (Th1), natural killer cells (NK cells), dendritic cells, mast cells, alveolar macrophages, eosinophils, and human airway epithelial cells. CXCR3 is important for effector lymphocyte recruitment into inflamed tissue in various inflammatory and autoimmune diseases, such as chronically inflamed liver, Crohn's disease, rheumatoid arthritis, multiple sclerosis, and inflammatory skin diseases.
10μg
Verified Reactivity: Human, Cynomolgus, Rhesus
Reported Reactivity: African Green, Baboon
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human CXCR3 transfectants
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_2894580 (BioLegend Cat. No. 353757)
Structure: CXC-chemokine receptor, G protein-coupled receptor, seven-pass transmembrane receptor
Distribution: T cell subset, NK cells, plasmacytoid dendritic cells, GM-CSF activated CD34+ hematopoietic progenitors, mast cells, alveolar macrophages, eosinophils, and airway epithelial cells
Function: Essential in T cell recruitment to sites of inflammation
Ligand/Receptor: CXCL9, CXCL10, and CXCL11
Cell Type: Dendritic cells, Eosinophils, Epithelial cells, Hematopoietic stem and progenitors, Macrophages, Mast cells, NK cells, T cells, Tregs
Biology Area: Cell Biology, Immunology, Neuroinflammation, Neuroscience
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References: 1. Loetscher M, et al. 1996. J. Exp. Med. 184:963. 2. Cole KE, et al. 1998. J. Exp. Med. 187:2009. 3. Aksoy MO, et al. 2006. Am. J. Physiol. Lung Cell Mol. Physiol. 290:L909. 4. Curbishley SM, et al. 2005. Am. J. Pathol. 167:887. 5. Turner JE, et al. 2007. Mini. Rev. Med. Chem. 7:1089. 6. Wenzel J, et al. 2008. J. Invest. Dermatol. 128:67.
Gene ID: 2833
UniProt: View information about CD183 on UniProt.org
Clone: G025H7
Regulatory Status: RUO
Other Names: CXCR3, G protein-coupled receptor 9 (GPR9), CKR-L2
Isotype: Mouse IgG1, κ
Barcode Sequence: GCGATGGTAGATTAT
Q: Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?
A: Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmation.
3. Minimum order value of $1,000 USD required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924