Iright
BRAND / VENDOR: Biolegend

Biolegend, 359141, TotalSeq™-D0141 anti-human CD195 (CCR5) Antibody, 10μg

CATALOG NUMBER: 359141
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD195, also known as CCR5, is a 45 kD G protein-coupled seven transmembrane CC-chemokine receptor. It binds to MIP-1α, MIP-1β, and RANTES and is expressed on a subset of T cells and monocytes. CCR5 mediates an intracellular signal thought to induce cell differentiation and proliferation. CCR5 has also been shown to act as a co-receptor for R5 HIV-1 cell entry; modification of CCR5 by sulfation contributes to the efficiency of HIV-1 entry. Studies have shown CCR5 to play a role in a variety of other human diseases, ranging from infectious and inflammatory diseases to cancer.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Rat
Immunogen: Human CCR5 transfectants
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_2894570 (BioLegend Cat. No. 359141)
Structure: G-coupled receptor family 1, membrane protein, 45 kD
Distribution: Subset of T cells, monocytes
Function: Binds C-C chemokines and transduces an intracellular signal thought to result in proliferation and differentiation, acts as a co-receptor with CD4 for HIV-1
Ligand/Receptor: MIP-1α, MIP-1β, RANTES
Cell Type: Monocytes, T cells
Biology Area: Cell Biology, Immunology, Innate Immunity, Neuroinflammation, Neuroscience
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References: 1. Samson M, et al. 1996. Biochemistry 35:3362. 2. Raport CJ, et al. 1996. J. Biol. Chem. 271:17161. 3. Combadiere C, et al. 1996. J. Leukoc. Biol. 60:147. 4. Deng H, et al. 1996. Nature 381:661. 5. Lai J, et al. 2003. CVI. 10:1123. 6. Mañes S, et al. 2003. J. Exp. Med. 198:1381. 7. Vaday GG, et al. 2006. Prostate 66:124.
Gene ID: 1234
UniProt: View information about CD195 on UniProt.org
Clone: J418F1
Regulatory Status: RUO
Other Names: C-C chemokine receptor type 5 (CCR5), HIV-1 fusion co-receptor
Isotype: Rat IgG2b, κ
Barcode Sequence: CCAAAGTAAGAGCCA
Q: Does staining at room temperature or even at 37°C help for checking chemokine receptors expression?
A: Due to continuous recycling of many chemokine receptors, it may be worthwhile to consider staining at room temperature or at 37°C if the staining at lower temperature (which can potentially reduce receptor turnover) is not optimal.


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924