Biolegend, 359521, TotalSeq™-D0985 anti-human CD360 (IL-21R) Antibody, 10μg

Human interleukin 21 receptor (IL-21R) is a single pass type I membrane protein and a member of the type I cytokine receptor family. Of the type I cytokine receptors, IL-21R exhibits greatest extracellular homology to the IL-2R beta subunit (i.e., it contains one copy of the WSXWS-containing cytokine-binding domain). Intracellular domains of IL-21R include the Box 1 and Box 2 elements, which are similar to the IL-9R intracellular region. Upon binding IL-21, IL-21R forms a heterodimer with the common gamma subunit (CD132) and induces Jak/Stat signaling. IL-21R is expressed on B cells and at various levels on NK and T cells. IL-21 is a potent immunomodulatory cytokine mainly produced by NKT and CD4 T-cells (particularly the inflammatory Th17 subset) and has pleiotropic effects on both innate and adaptive immune responses. These actions include positive effects such as enhanced proliferation of natural killer (NK) cells and cytotoxic T cells that can destroy virally infected or cancerous cells and direct inhibitory effects on the antigen-presenting function of dendritic cells, and can be proapoptotic for B cells and NK cells. Studies have shown that IL-21 is also an autocrine cytokine that potently induces Th17 differentiation and suppresses Foxp3 expression, and serves as a target for treating inflammatory diseases.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human IL-21R expressing mouse M1-T22 cell line.
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: Additional reported applications (for the relevant formats) include: immunofluorescent surface staining1.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Bannantine J, et al. 2011. Front Microbiol. 2:163. (IF)
RRID: AB_2904382 (BioLegend Cat. No. 359521)
Structure: Single pass type I membrane protein, extracellular WSXWS-containing cytokine-binding domain, intracellular Box1 and Box2 domains
Distribution: B cells, various levels on NK cells, T cells, NKT cells, B cells, DCs, macrophages, non-hematopoietic cells, including keratinocytes and fibroblasts
Ligand/Receptor: IL-21
Cell Type: B cells, Dendritic cells, Fibroblasts, Macrophages, NK cells, NKT cells, T cells, Tregs
Biology Area: Immunology, Innate Immunity
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors
Antigen References: 1. Parrish-Novak J, et al. 2002. J. Leukocyte Biol. 72:856. 2. de Totero D, et al. 2006. Blood 107:3708. 3. Asao H, et al. 2001. J. Immunol. 167:1. 4. Davis ID, et al. 2007. Clin. Cancer Res. 13:6926. 5. Nurieva R. 2007. Nature. 448:480. 6. Dumoutier L, et al. 2000. Proc. Natl. Acad. Sci. USA 97:10144. 7. Ozaki, K, et al. 2000. Proc. Natl. Acad. Sci. USA 97:11439. 8. Parrish-Novak J, et al. 2000. Nature 408:57. 9. Spolski R and Leonard WJ. et al. 2008. Annu. Rev. Immunol. 26:57.
Gene ID: 50615
UniProt: View information about CD360 on UniProt.org
Clone: 17A12
Regulatory Status: RUO
Other Names: IL-21 Receptor, novel interleukin receptor (NILR), MGC10967
Isotype: Mouse IgG1, κ
Barcode Sequence: GAGGATGATGCCATG