Iright
BRAND / VENDOR: Biolegend

Biolegend, 362567, TotalSeq™-D0047 anti-human CD56 (NCAM) Antibody, 10μg

CATALOG NUMBER: 362567
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD56 is a single transmembrane glycoprotein also known as NCAM (neural cell adhesion molecule), Leu-19, or NKH1. It is a member of the Ig superfamily. The 140 kD isoform is expressed on NK and NKT cells. CD56 is also expressed in the brain (cerebellum and cortex) and at neuromuscular junctions. Certain large granular lymphocyte (LGL) leukemias, small-cell lung carcinomas, neuronal derived tumors, myelomas, and myeloid leukemias also express CD56. CD56 plays a role in homophilic and heterophilic adhesion via binding to itself or heparan sulfate.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human myotube cells
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Walsh FS, et al. 1981. Nature 289:60. (FC) Pavlath GK, et al. 1986. J. Cell Biol. 102:124. (FC) Pavlath GK, et al. 1989. Nature 337:570. (FC) Pulido R, et al. 1988. J. Immunol. 140:3851. (FC)
RRID: AB_2904383 (BioLegend Cat. No. 362567)
Structure: Ig superfamily, single transmembrane or GPI-anchored glycoprotein
Distribution: NK cells, T subset, neural tissue, some LGL and myeloid leukemias
Function: Adhesion
Ligand/Receptor: Heparan sulfate
Antigen References: 1. Lanier L, et al. 1991. J. Immunol. 146:4421 2. Hemperly J, et al. 1990. J. Mol. Neurosci. 2:71 3. Cremer H, et al. 1994. Nature 367:455.
Gene ID: 4684
UniProt: View information about CD56 on UniProt.org
Clone: 5.1H11
Regulatory Status: RUO
Other Names: Leu-19, NKH1, NCAM-1
Isotype: Mouse IgG1, κ
Barcode Sequence: TCCTTTCCTGATAGG


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924