Iright
BRAND / VENDOR: Biolegend

Biolegend, 362919, TotalSeq™-D1261 anti-human CD191 (CCR1) Antibody, 10μg

CATALOG NUMBER: 362919
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD191, also known as CCR1, is a 41 kD, G-protein coupled receptor expressed predominantly by monocytes. CCR1 is also expressed by a subset of T cells and eosinophils. CCR1 positive cells can migrate in response to a CCL3 and CCL5 gradient. CCR1 knock-out studies suggest that this molecule plays an important role in inflammation and susceptibility to viruses and parasites.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human CCR1 transfected cells
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein.To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions.Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dnaThe barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation.View more applications data for this product in our Application Technical Notes.
RRID: AB_2936584 (BioLegend Cat. No. 362919)
Structure: G-protein coupled receptor, seven transmembrane protein, 41 kD
Distribution: Monocytes, macrophages, subset of T cells, eosinophils
Function: Regulates migration of cells in response to CCL3 and CCL5
Ligand/Receptor: CCL3 and CCL5
Cell Type: Eosinophils, Macrophages, Monocytes, T cells
Biology Area: Immunology
Molecular Family: CD Molecules, Cytokine/Chemokine Receptors, GPCR
Antigen References: 1. Su SB, et al. 1996. J. Leuko. Biol. 60:658. 2. Su S, et al. 1997. Blood. 90:605. 3. Ayehunie S, et al. 1997. Blood. 90:1379. 4. Gerard C, et al. 1997. J. Clin. Invest. 100:2022. 5. Tiffany HL, et al. 1998. J. Immunol. 160:1385. 6. Gilliland CT, et al. 2013. J. Biol. Chem. 288:32194. 7. Bednar F, et al. 2014. J. Immunol. 192:5305.
Gene ID: 1230
UniProt: View information about CD191 on UniProt.org
Clone: 5F10B29
Regulatory Status: RUO
Other Names: CKR1, CD191, HM145, SCYAR1, CMKRB1
Isotype: Mouse IgG1, κ
Barcode Sequence: CCTTTCCGACATTGG


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924