Iright
BRAND / VENDOR: Biolegend

Biolegend, 372739, TotalSeq™-D0089 anti-human TIGIT (VSTM3) Antibody, 10μg

CATALOG NUMBER: 372739
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

T cell immunoreceptor with Ig and ITIM domains (TIGIT), also known as VSTM3 or WUCAM, is a 26 kD, type I transmembrane protein and is a member of the PVR (poliovirus receptor) family of immunoglobulin-like domain containing proteins. TIGIT is expressed on activated T cells, follicular T helper, memory, and regulatory T cells as well as on NK cells. TIGIT is a negative regulator of NK and T cell activation. Expression of TIGIT is associated with decreased functionality of CD8 T cells in chronic viral infection and tumors. TIGIT also promotes the differentiation of tolerogenic phenotype in dendritic cells with an increased secretion of IL-10 and a diminished production of IL-12.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Recombinant Human TIGIT.
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Application Notes: This clone can suppress anti-CD3 induced T cell proliferation in vitro based on in-house testing.This clone has been tested in-house and determined to not be suitable for applications in immunohistochemistry of paraffin-embedded tissue sections (IHC-P).Additional reported applications (for the relevant formats) include: Blocking1.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
Application References(PubMed link indicates BioLegend citation): Stamm H, et al. 2018. Oncogene. Pubmed
RRID: AB_2892456 (BioLegend Cat. No. 372739)
Structure: 26kD; type I transmembrane protein, Ig-like V-type domain, ITIM motif.
Distribution: Activated T cells, Regulatory T cells (Treg), Follicular Helper T cells (TFH), NK cells.
Function: Cell signaling, negative regulation of T cells, T cell tolerance, T cell anergy.
Ligand/Receptor: CD155 (PVR), CD112 (PVRL2, NECTIN-2).
Cell Type: NK cells, T cells, Tfh, Tregs
Biology Area: Cell Adhesion, Cell Biology, Immunology, Inhibitory Molecules, Signal Transduction
Molecular Family: Adhesion Molecules, Immune Checkpoint Receptors
Antigen References: 1. Stanietsky N, et al. 2009. Proc. Natl. Acad. Sci. 106:17858. 2. Yu X, et al. 2009. Nat. Immunol. 10:48. 3. Johnston R, et al. 2014. Cancer Cell. 26:923.
Gene ID: 201633
UniProt: View information about TIGIT on UniProt.org
Clone: A15153G
Regulatory Status: RUO
Other Names: T-cell immunoreceptor with Ig and ITIM domains, VSIG9, VSTM3, WUCAM
Isotype: Mouse IgG2a, κ
Barcode Sequence: TTGCTTACCGCCAGA


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924