Iright
BRAND / VENDOR: Biolegend

Biolegend, 393721, TotalSeq™-D0598 anti-human CD110 Antibody, 10μg

CATALOG NUMBER: 393721
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

CD110 is a type I transmembrane glycoprotein which functions as a receptor for thrombopoietin; binding causes the proliferation and differentiation of megakaroyocytes in addition to the production of platelets and protection of stem cells from apoptosis. CD110 is primarily expressed on hematopoietic stem cells, hematopoietic precursor cells, cells of the megakaryocytic lineage, and platelets.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human CD110 transfectants
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_3717212 (BioLegend Cat. No. 393721)
Structure: Type I transmembrane glycoprotein
Distribution: Hematopoietic stem cells, a subfraction of hematopoietic precursor cells, cells of the megakaryocytic lineage, and platelets.
Function: Megakaryocytopoiesis and platelet formation
Interaction: THPO, ATXN2L, JAK2
Ligand/Receptor: Thrombopoietin
Cell Type: Hematopoietic stem and progenitors, Megakaryocytes, Platelets
Biology Area: Immunology
Molecular Family: CD Molecules
Antigen References: Ninos JM, et al. 2006. J. Transl. Med. 16:4-9. Broudy VC, et al. 1996. Blood. 88:2026-32. Wang X, et al. 2016. Blood. 127:3398-409.
Gene ID: 4352
UniProt: View information about CD110 on UniProt.org
Clone: S16017E
Regulatory Status: RUO
Other Names: TPOR, c-MPL, MPLV
Isotype: Mouse IgG2a, κ
Barcode Sequence: TGTTGTAAGATGCCA


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924