Iright
BRAND / VENDOR: Biolegend

Biolegend, 394203, TotalSeq™-D1172 anti-human IL12RB2 Antibody, 10μg

CATALOG NUMBER: 394203
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description

IL12RB2 is a type I transmembrane protein that foms an heterodimer with IL12RB1 to produce the high affinity IL-12 receptor complex. IL12RB2 is expressed by activated T cells, TH1 cells, NK cells, B cells and plasma cells. Variants of this gene are associated with predisposition to various immune-related diseases.
10μg
Verified Reactivity: Human
Antibody Type: Monoclonal
Host Species: Mouse
Immunogen: Human IL12RB2 transfected cells.
Formulation: Phosphate-buffered solution, pH 7.2, containing 0.09% sodium azide and EDTA
Preparation: The antibody was purified by chromatography and conjugated with TotalSeq™-D oligomer under optimal conditions.
Concentration: 0.5 mg/mL
Storage & Handling: The antibody solution should be stored undiluted between 2°C and 8°C. Do not freeze.
Application: PG - Quality tested
Recommended Usage: Each lot of this antibody is quality control tested by immunofluorescent staining with flow cytometric analysis and the oligomer sequence is confirmed by sequencing. TotalSeq™-D antibodies are compatible with Mission Bio’s Tapestri Single-Cell Sequencing Platform for simultaneous detection of DNA and Protein. To maximize performance, it is strongly recommended that the reagent be titrated for each application, and that you centrifuge the antibody dilution before adding to the cells at 14,000xg at 2 - 8°C for 10 minutes. Carefully pipette out the liquid avoiding the bottom of the tube and add to the cell suspension. For Proteogenomics analysis, the suggested starting amount of this reagent for titration is ≤ 1.0 µg per million cells in 100 µL volume. Refer to the corresponding TotalSeq™ protocol for specific staining instructions. Buyer is solely responsible for determining whether Buyer has all intellectual property rights that are necessary for Buyer's intended uses of the BioLegend TotalSeq™ products. For example, for any technology platform Buyer uses with TotalSeq™, it is Buyer's sole responsibility to determine whether it has all necessary third party intellectual property rights to use that platform and TotalSeq™ with that platform.
Additional Product Notes: TotalSeq™-D reagents are designed to profile protein expression at single cell level. The Mission Bio Tapestri platform and sequencer (e.g. Illumina analyzers) are required. Please contact technical support for more information, or visit biolegend.com/totalseq/single-cell-dna The barcode flanking sequences are CGAGATGACTACGCTACTCATGG (PCR handle), and GAGCCGATCTAGTATCTCAGT*C*G (capture sequence). * indicates a phosphorothioated bond, to prevent nuclease degradation. View more applications data for this product in our Application Technical Notes.
RRID: AB_2894596 (BioLegend Cat. No. 394203)
Structure: Type I transmembrane protein, 3 isoforms, foms an heterodimer with IL12RB1
Distribution: Activated T cells, TH1 cells, NK cells, B cells, plasma cells
Function: Role in TH1 differentiation
Ligand/Receptor: IL-12
Cell Type: B cells, NK cells, Plasma cells, T cells, Th1
Biology Area: Immunology
Molecular Family: Cytokine/Chemokine Receptors
Antigen References: LaMere SA, et al. 2017. J Immunol. 199:3158 Prigione I, et al. 2016. Immunobiology. 221:291 de Paus RA, et al. 2013. Mol Immunol. 56:380 Airoldi I, et al. 2008. Blood. 112:750
Gene ID: 3595
UniProt: View information about IL12RB2 on UniProt.org
Clone: S16020B
Regulatory Status: RUO
Other Names: Interleukin-12 receptor subunit beta-2
Isotype: Mouse IgG2a, κ
Barcode Sequence: TCCCTCAGCGATTTA


Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924