Proteintech, G11247-2-5C, MultiPro® 5CFLX Anti-Human MUM1/IRF4 (Polyclonal)

Size: 10ug The MUM1/IRF4 (G11247-2-5C) by Proteintech is a Polyclonal antibody targeting MUM1/IRF4 in Single Cell (Intra) applications with reactivity to Human samples G11247-2-5C targets MUM1/IRF4 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information IRF4 is a member of the IRF family of transcription factors, expressed in most cell types of the immune system. IRF4 is a transcription factor essential for the development of T helper-2 (Th2) cells, IL17-producing Th17 cells, and IL9-producing Th9 cells, as well as dendritic cell (DC). It binds to and activates the ISRE of the MHC class I promoter, and may have a role in ISRE-targeted signal transduction mechanisms specific to lymphoid cells. Specification Tested Reactivity: Human Host / Isotype: Rabbit / IgG Class: Oligo Conjugate Type: Polyclonal Immunogen: CatNo: Ag1762 Product name: Recombinant human IRF4 protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 1-451 aa of BC015752 Sequence: MNLEGGGRGGEFGMSAVSCGNGKLRQWLIDQIDSGKYPGLVWENEEKSIFRIPWKHAGKQDYNREEDAALFKAWALFKGKFREGIDKPDPPTWKTRLRCALNKSNDFEELVERSQLDISDPYKVYRIVPEGAKKGAKQLTLEDPQMSMSHPYTMTTPYPSLPAQQVHNYMMPPLDRSWRDYVPDQPHPEIPYQCPMTFGPRGHHWQGPACENGCQVTGTFYACAPPESQAPGVPTEPSIRSAEALAFSDCRLHICLYYREILVKELTTSSPEGCRISHGHTYDASNLDQVLFPYPEDNGQRKNIEKLLSHLERGVVLWMAPDGLYAKRLCQSRIYWDGPLALCNDRPNKLERDQTCKLFDTQQFLSELQAFAHHGRSLPRFQVTLCFGEEFPDPQRQRKLITAHVEPLLARQLYYFAQQNSGHFLRGYDLPEHISNPEDYHRSIRHSSIQE Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human MUM1/IRF4 (Polyclonal) Calculated Molecular Weight: 52 kDa GenBank Accession Number: BC015752 Gene Symbol: IRF4 Gene ID (NCBI): 3662 ENSEMBL Gene ID: ENSG00000137265 RRID: AB_3673882 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGAGTGCTTCTAGCCGACCCATATAAGAAA Barcode Sequence: AGTGCTTCTAGCCGA Form: Liquid UNIPROT ID: Q15306 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.