Iright
BRAND / VENDOR: Proteintech

Proteintech, G13700-1-5C, MultiPro® 5CFLX Anti-Human TBX21/T-bet (Polyclonal)

CATALOG NUMBER: G13700-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The TBX21,T-bet (G13700-1-5C) by Proteintech is a Polyclonal antibody targeting TBX21,T-bet in Single Cell (Intra) applications with reactivity to Human samples G13700-1-5C targets TBX21,T-bet in Single Cell (Intra) applications and shows reactivity with Human samples. Background Information TBX21 is a transcription factor that drives the Th1 immune response primarily through promoting expression of the IFN-γ gene. TBX21 initiates TH1 lineage development from naive TH precursor cells both by activating TH1 genetic programs and by repressing the opposing TH2 programs. It has also been shown to play an influential role in inflammatory processes such as inflammatory bowel disease, autoimmune diseases such as rheumatoid arthritis, and immune-mediated conditions like asthma. Specification Tested Reactivity: Human Host / Isotype: Rabbit / IgG Class: Oligo Conjugate Type: Polyclonal Immunogen: CatNo: Ag4618 Product name: Recombinant human TBX21,T-bet protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 1-328 aa of BC039739 Sequence: MGIVEPGCGDMLTGTEPMPGSDEGRAPGADPQHRYFYPEPGAQDADERRGGGSLGSPYPGGALVPAPPSRFLGAYAYPPRPQAAGFPGAGESFPPPADAEGYQPGEGYAAPDPRAGLYPGPREDYALPAGLEVSGKLRVALNNHLLWSKFNQHQTEMIITKQGRRMFPFLSFTVAGLEPTSHYRMFVDVVLVDQHHWRYQSGKWVQCGKAEGSMPGNRLYVHPDSPNTGAHWMRQEVSFGKLKLTNNKGASNNVTQMIVLQSLHKYQPRLHIVEVNDGEPEAACNASNTHIFTFQETQFIAVTAYQNAEITQLKIDNNPFAKGFRENF Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human TBX21/T-bet (Polyclonal) Calculated Molecular Weight: 535 aa, 58 kDa GenBank Accession Number: BC039739 Gene Symbol: TBX21/T-bet Gene ID (NCBI): 30009 ENSEMBL Gene ID: ENSG00000073861 RRID: AB_3673886 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGGTTCAATCCGGACGCCCATATAAGAAA Barcode Sequence: GGTTCAATCCGGACG Form: Liquid UNIPROT ID: Q9UL17 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924