Proteintech, G60200-1-5C, MultiPro® 5CFLX Anti-Human ZAP70 (1A11G9)

Size: 10ug The ZAP70 (G60200-1-5C) by Proteintech is a Monoclonal antibody targeting ZAP70 in Single Cell (Intra) applications with reactivity to Human samples G60200-1-5C targets ZAP70 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information Zeta-associated protein (ZAP)-70, a member of the Syk family of tyrosine kinases, plays an important role in T-cell receptor signaling, natural killer (NK) cell activation and early B-cell development. ZAP-70 is expressed in a subset of cases of chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL) with unmutated immunoglobulin heavy-chain variable region (IgVH) genes and is associated with poor clinical outcome. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2a Class: Oligo Conjugate Type: Monoclonal Immunogen: CatNo: Ag7943 Product name: Recombinant human ZAP70 protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 149-493 aa of BC039039 Sequence: STLTHPQRRIDTLNSDGYTPEPARITSPDKPRPMPMDTSVYESPYSDPEELKDKKLFLKRDNLLIADIELGCGNFGSVRQGVYRMRKKQIDVAIKVLKQGTEKADTEEMMREAQIMHQLDNPYIVRLIGVCQAEALMLVMEMAGGGPLHKFLVGKREEIPVSNVAELLHQVSMGMKYLEEKNFVHRDLAARNVLLVNRHYAKISDFGLSKALGADDSYYTARSAGKWPLKWYAPECINFRKFSSRSDVWSYGVTMWEALSYGQKPYKKMKGPEVMAFIEQGKRMECPPECPPELYALMSDCWIYKWEDRPDFLTVEQRMRACYYSLASKVEGPPGSTQKAEAACA Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human ZAP70 (1A11G9) Calculated Molecular Weight: 70 kDa GenBank Accession Number: BC039039 Gene Symbol: ZAP70 Gene ID (NCBI): 7535 ENSEMBL Gene ID: ENSG00000115085 RRID: AB_3673899 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCTCTACCGCGCGACGCCCATATAAGAAA Barcode Sequence: CTCTACCGCGCGACG Form: Liquid UNIPROT ID: P43403 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.