Proteintech, G65090-1-5C, MultiPro® 5CFLX Anti-Human CD16 (3G8)

Size: 10ug The CD16 (G65090-1-5C) by Proteintech is a Monoclonal antibody targeting CD16 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65090-1-5C targets CD16 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD16 is a 50-70-kDa low affinity Fc receptor found on the surface of natural killer cells, neutrophil polymorphonuclear leukocytes, monocytes and macrophages. CD16 mediates antibody-dependent cellular cytotoxicity (ADCC) and other antibody-dependent responses, such as phagocytosis. CD16 has been identified as Fc receptors FcγRIIIa (CD16a) and FcγRIIIb (CD16b), encoded by two nearly identical genes, FCGR3A and the FCGR3B. Clone 3G8 recognizes both the CD16a and CD16b (PMID: 7592758). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: N/A Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD16 (3G8) Calculated Molecular Weight: 254 aa, 29 kDa GenBank Accession Number: BC017865 Gene Symbol: CD16a Gene ID (NCBI): 2214 ENSEMBL Gene ID: ENSG00000203747 RRID: AB_3673911 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTGTGGAGTCTGGATCCCATATAAGAAA Barcode Sequence: GTGTGGAGTCTGGAT Form: Liquid Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.