Iright
BRAND / VENDOR: Proteintech

Proteintech, G65109-1-5C, MultiPro® 5CFLX Anti-Human CD45 (HI30)

CATALOG NUMBER: G65109-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The CD45 (G65109-1-5C) by Proteintech is a Monoclonal antibody targeting CD45 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65109-1-5C targets CD45 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD45, also known as protein tyrosine phosphatase, receptor type C, is a type I transmembrane protein expressed on the surface of all haematopoietic cells with the exception of erythrocytes and platelets (PMID: 3489673; 28615666). CD45 is a pan-haematopoietic cell marker and has been shown to be essential for T- and B-cell activation and signalling (PMID: 9429890; 16378097). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Human peripheral blood leucocytes Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD45 (HI30) GenBank Accession Number: BC014239 Gene Symbol: CD45 Gene ID (NCBI): 5788 ENSEMBL Gene ID: ENSG00000081237 RRID: AB_3673914 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGTGAGCCAATTACCCCCATATAAGAAA Barcode Sequence: TGTGAGCCAATTACC Form: Liquid UNIPROT ID: P08575 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924