Proteintech, G65110-1-5C, MultiPro® 5CFLX Anti-Human CD19 (HIB19)

Size: 10ug The CD19 (G65110-1-5C) by Proteintech is a Monoclonal antibody targeting CD19 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65110-1-5C targets CD19 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD19 is a 95 kDa type I transmembrane glycoprotein belonging to the immunoglobulin superfamily (PMID: 2472450). It is expressed by B cells and follicular dendritic cells. CD19 is up-regulated at the step of B-lineage commitment during the differentiation of the hematopoietic stem cell, it remains on during subsequent stages of differentiation until finally down-regulated during terminal differentiation into plasma cells (PMID: 8528044). CD19 is involved in B cell development, activation and differentiation. It is the dominant component for the signaling complex on B cells that includes CD21 (CR2), CD81 (TAPA-1) and CD225 and acts as a critical co-receptor for BCR signal transduction (PMID: 23210908). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: N/A Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD19 (HIB19) Calculated Molecular Weight: 556 aa, 61 kDa GenBank Accession Number: BC006338 Gene Symbol: CD19 Gene ID (NCBI): 930 ENSEMBL Gene ID: ENSG00000177455 RRID: AB_3673915 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGGCTGGTCCTTCATCCCATATAAGAAA Barcode Sequence: CGGCTGGTCCTTCAT Form: Liquid Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.