Iright
BRAND / VENDOR: Proteintech

Proteintech, G65116-1-5C, MultiPro® 5CFLX Anti-Human CD11b (ICRF44)

CATALOG NUMBER: G65116-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The CD11b (G65116-1-5C) by Proteintech is a Monoclonal antibody targeting CD11b in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65116-1-5C targets CD11b in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information Integrins are cell adhesion receptors that are heterodimers composed of non-covalently associated α and β subunits (PMID: 9779984). CD11b, also known as Integrin alpha M or CR3A, belongs to the integrin alpha chain family. CD11b forms an α/β heterodimer with CD18 (integrin β2). CD11b/CD18 is implicated in various adhesive interactions of monocytes, macrophages and granulocytes as well as in mediating the uptake of complement-coated particles and pathogens (PMID: 9558116; 20008295). CD11b/CD18 is a receptor for the complement protein fragment iC3b, and is also a receptor for fibrinogen, factor X and ICAM1 (PMID: 2971974; 15485828). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Rheumatoid synovial cells and human monocytes Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD11b (ICRF44) Calculated Molecular Weight: 1152 aa, 127 kDa GenBank Accession Number: BC096346 Gene Symbol: CD11b Gene ID (NCBI): 3684 ENSEMBL Gene ID: ENSG00000169896 RRID: AB_3673917 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCAGTCAATAGCTATCCCATATAAGAAA Barcode Sequence: CCAGTCAATAGCTAT Form: Liquid UNIPROT ID: P11215 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924