Iright
BRAND / VENDOR: Proteintech

Proteintech, G65143-1-5C, MultiPro® 5CFLX Anti-Human CD4 (RPA-T4)

CATALOG NUMBER: G65143-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The CD4 (G65143-1-5C) by Proteintech is a Monoclonal antibody targeting CD4 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65143-1-5C targets CD4 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD4 is a 55-kDa transmembrane glycoprotein expressed on T helper cells, majority of thymocytes, monocytes, macrophages, and dendritic cells (PMID: 9304802; 12213222). CD4 is an accessory protein for MHC class-II antigen/T-cell receptor interaction. It plays an important role in T helper cell development and activation (PMID: 9539765; 3112582). CD4 serves as a receptor for the human immunodeficiency virus (HIV) (PMID: 9304802). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1 Class: Oligo Conjugate Type: Monoclonal Immunogen: N/A Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD4 (RPA-T4) Calculated Molecular Weight: 55 kDa GenBank Accession Number: BC025782 Gene Symbol: CD4 Gene ID (NCBI): 920 ENSEMBL Gene ID: ENSG00000010610 RRID: AB_3673919 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTCTTACAACGCAGTCCCATATAAGAAA Barcode Sequence: GTCTTACAACGCAGT Form: Liquid UNIPROT ID: P01730 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924