Proteintech, G65152-1-5C, MultiPro® 5CFLX Anti-Human CD5 (UCHT2)

Size: 10ug The CD5 (G65152-1-5C) by Proteintech is a Monoclonal antibody targeting CD5 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65152-1-5C targets CD5 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD5 is a type I transmembrane glycoprotein of the scavenger receptor cysteine-rich family (PMID: 12403363). CD5 is expressed on a majority of thymocytes, mature T cells, B cell subsets, and peripheral blood dendritic cells (PMID: 9858516; 6156984; 10379049; 1384337). CD5 may act as a receptor in regulating T-cell proliferation. It functions as a negative regulator of TCR signaling during thymocyte development (PMID: 7542801). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: N/A Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD5 (UCHT2) Calculated Molecular Weight: 495 aa, 55 kDa GenBank Accession Number: BC027901 Gene Symbol: CD5 Gene ID (NCBI): 921 ENSEMBL Gene ID: ENSG00000110448 RRID: AB_3673921 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGGTGCCTCGCATTGCACCCATATAAGAAA Barcode Sequence: GTGCCTCGCATTGCA Form: Liquid Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.