Iright
BRAND / VENDOR: Proteintech

Proteintech, G65165-1-5C, MultiPro® 5CFLX Anti-Human CD86 (BU63)

CATALOG NUMBER: G65165-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The CD86 (G65165-1-5C) by Proteintech is a Monoclonal antibody targeting CD86 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65165-1-5C targets CD86 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD86 (also known as B7.2) is a costimulatory molecule belonging to the immunoglobulin superfamily. Primarily expressed on antigen-presenting cells (APCs), including B cells, dendritic cells, and macrophages, CD86 is the ligand for two proteins at the cell surface of T cells, CD28 antigen and cytotoxic T-lymphocyte-associated protein 4. Binding of CD86 with CD28 antigen is a costimulatory signal for activation of the T-cell. Binding of CD86 with cytotoxic T-lymphocyte-associated protein 4 negatively regulates T-cell activation and diminishes the immune response. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: B-lymphoblastoid cell line ARH 77 Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD86 (BU63) Calculated Molecular Weight: 329 aa, 38 kDa GenBank Accession Number: BC040261 Gene Symbol: CD86 Gene ID (NCBI): 942 ENSEMBL Gene ID: ENSG00000114013 RRID: AB_3673923 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCGAGTTGCGAAGTTCCCATATAAGAAA Barcode Sequence: CCGAGTTGCGAAGTT Form: Liquid UNIPROT ID: P42081 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924