Iright
BRAND / VENDOR: Proteintech

Proteintech, G65167-1-5C, MultiPro® 5CFLX Anti-Human CD62L (DREG56)

CATALOG NUMBER: G65167-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The CD62L (G65167-1-5C) by Proteintech is a Monoclonal antibody targeting CD62L in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65167-1-5C targets CD62L in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD62L, also known as L-selectin or SELL, is a member of the selectin family of adhesion molecules that also include CD62E (E-selectin) and CD62P (P-selectin) (PMID: 2663882, 2473156, 1382078). CD62L is a highly glycosylated protein of 95-105 kDa on neutrophils and 74 kDa on lymphocytes (PMID: 1382078; 1694883, 1695155). CD62L is expressed on the surface of most leukocytes, including lymphocytes, neutrophils, monocytes, eosinophils, hematopoietic progenitor cells, and immature thymocytes (PMID: 1694883, 1688580). It mediates the binding of lymphocytes to high endothelial venules (HEV) of peripheral lymph nodes through interactions with a constitutively expressed ligand, and is also involved in lymphocyte, neutrophil, and monocyte attachment to endothelium at sites of inflammation (PMID: 1382078). Specification Tested Reactivity: Human Host / Isotype: Mouse / Mouse IgG1 Class: Oligo Conjugate Type: Monoclonal Immunogen: PMA-activated human peripheral blood leukocytes Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD62L (DREG56) Calculated Molecular Weight: 42 kDa GenBank Accession Number: BC020758 Gene Symbol: CD62L Gene ID (NCBI): 6402 ENSEMBL Gene ID: ENSG00000188404 RRID: AB_3673924 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTTCCGGTTCTTGAATCCCATATAAGAAA Barcode Sequence: TTCCGGTTCTTGAAT Form: Liquid UNIPROT ID: P14151 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924