Proteintech, G65171-1-5C, MultiPro® 5CFLX Anti-Human CD83 (HB15e)

Size: 10ug The CD83 (G65171-1-5C) by Proteintech is a Monoclonal antibody targeting CD83 in Single Cell (Intra) applications with reactivity to Human samples G65171-1-5C targets CD83 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Specification Tested Reactivity: Human Host / Isotype: Mouse / Mouse IgG1 kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Human CD83-transfected Cos cells Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD83 (HB15e) Calculated Molecular Weight: 205 aa, 23 kDa GenBank Accession Number: BC030830 Gene Symbol: CD83 Gene ID (NCBI): 9308 ENSEMBL Gene ID: ENSG00000112149 RRID: AB_3673926 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGGCCAACTACACTGCCCATATAAGAAA Barcode Sequence: CGGCCAACTACACTG Form: Liquid UNIPROT ID: Q01151 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.