Iright
BRAND / VENDOR: Proteintech

Proteintech, G65190-1-5C, MultiPro® 5CFLX Anti-Human CD18 (TS1/18)

CATALOG NUMBER: G65190-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The CD18 (G65190-1-5C) by Proteintech is a Monoclonal antibody targeting CD18 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65190-1-5C targets CD18 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD18, also known as integrin beta-2, is a transmembrane protein that forms heterodimers with CD11a, CD11b, CD11c, CD11d (PMID: 1968349). CD11a/CD18 (LFA-1) is expressed by all leukocytes, while CD11b/CD18 (Mac-1) and CD11c/CD18 (p150,95) are normally restricted to expression on monocytes, macrophages, polymorphonuclear lymphocytes (PMNs), and natural killer cells (PMID: 1968349; 3109455; 10946284). CD18 plays an important role in mediating cell adhesion during immune response and defects of CD18 cause leukocyte adhesion deficiency (PMID: 3594570). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Human Beta 2 Integrin Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD18 (TS1/18) Calculated Molecular Weight: 85 kDa GenBank Accession Number: BC005861 Gene Symbol: CD18 Gene ID (NCBI): 3689 ENSEMBL Gene ID: ENSG00000160255 RRID: AB_3673928 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGTGGTTGGAAGCACCCCATATAAGAAA Barcode Sequence: CGTGGTTGGAAGCAC Form: Liquid UNIPROT ID: P05107 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924