Iright
BRAND / VENDOR: Proteintech

Proteintech, G65191-1-5C, MultiPro® 5CFLX Anti-Human CD29 (TS2/16)

CATALOG NUMBER: G65191-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The CD29 (G65191-1-5C) by Proteintech is a Monoclonal antibody targeting CD29 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65191-1-5C targets CD29 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information Integrin beta-1 (ITGB1), also named as CD29, is a 130 kDa single chain type I glycoprotein that is expressed in a heterodimeric complex with one of six distinct α subunits, comprising the very late activation antigen (VLA) subfamily of adhesion receptors. It is one of the essential surface molecules expressed on human MSC from bone marrow and other sources. The β1 subunit is also broadly expressed on lymphocytes and monocytes, weakly expressed on granulocytes, and not expressed on erythrocytes. These receptors are involved in a variety of cell-cell and cell-matrix interactions. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: N/A Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD29 (TS2/16) Calculated Molecular Weight: 88 kDa GenBank Accession Number: BC020057 Gene Symbol: Integrin beta 1 Gene ID (NCBI): 3688 ENSEMBL Gene ID: ENSG00000150093 RRID: AB_3673929 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGAGAGACACGCATCCCCATATAAGAAA Barcode Sequence: TGAGAGACACGCATC Form: Liquid UNIPROT ID: P05556 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924