Proteintech, G65192-1-5C, MultiPro® 5CFLX Anti-Human CD2 (TS1/8)

Size: 10ug The CD2 (G65192-1-5C) by Proteintech is a Monoclonal antibody targeting CD2 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65192-1-5C targets CD2 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD2 is a cell surface glycoprotein present on a majority of thymocytes, all mature T cells and subset of NK cells but not on B lymphocytes. It is a pan T-cell marker. CD2 interacts with lymphocyte function-associated antigen (LFA-3/CD58) and CD48/BCM1 to mediate adhesion between T-cells and other cell types. CD2 is implicated in the triggering of T-cells, the cytoplasmic domain is implicated in the signaling function. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: N/A Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD2 (TS1/8) Calculated Molecular Weight: 351 aa, 39 kDa GenBank Accession Number: BC033583 Gene Symbol: CD2 Gene ID (NCBI): 914 ENSEMBL Gene ID: ENSG00000116824 RRID: AB_3673930 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTAGAGACAGTTATAACCCATATAAGAAA Barcode Sequence: TAGAGACAGTTATAA Form: Liquid UNIPROT ID: P06729 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.