Iright
BRAND / VENDOR: Proteintech

Proteintech, G65194-1-5C, MultiPro® 5CFLX Anti-Human CD11a (TS2/4)

CATALOG NUMBER: G65194-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The CD11a (G65194-1-5C) by Proteintech is a Monoclonal antibody targeting CD11a in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65194-1-5C targets CD11a in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD11a, also known as integrin αL or LFA-1α, is a 170-180 kDa transmembrane glycoprotein that forms a heterodimer with CD18 (PMID: 7027264; 1672643). CD11a/CD18 (LFA-1) is expressed by all leukocytes and mediates cell adhesion through interactions with its ligands, intercellular adhesion molecule 1 (ICAM-1), ICAM-2, and ICAM-3 (PMID: 7479767). CD11a/CD18 also functions in lymphocyte costimulatory signaling (PMID: 1972160). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: HLA-DR CTL line Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD11a (TS2/4) Calculated Molecular Weight: 129 kDa GenBank Accession Number: BC008777 Gene Symbol: CD11a Gene ID (NCBI): 3683 ENSEMBL Gene ID: ENSG00000005844 RRID: AB_3673931 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCACTAGATGCTTGGCCCATATAAGAAA Barcode Sequence: CCACTAGATGCTTGG Form: Liquid UNIPROT ID: P20701 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924