Proteintech, G65218-1-5C, MultiPro® 5CFLX Anti-Human HLA-DR (L243)

Size: 10ug The HLA-DR (G65218-1-5C) by Proteintech is a Monoclonal antibody targeting HLA-DR in Single Cell (Intra) applications with reactivity to Human samples G65218-1-5C targets HLA-DR in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2a, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Human lymphoblastoid B-cell line RPMI 8866 Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human HLA-DR (L243) Calculated Molecular Weight: 254 aa, 29 kDa GenBank Accession Number: BC032350 Gene Symbol: HLA-DRA Gene ID (NCBI): 3122 ENSEMBL Gene ID: ENSG00000204287 RRID: AB_3673936 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGGTAACGCGCGGTTCCCATATAAGAAA Barcode Sequence: TGGTAACGCGCGGTT Form: Liquid UNIPROT ID: P01903 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.