Proteintech, G65226-1-5C, MultiPro® 5CFLX Anti-Human CD45RA (F8-11-13)

Size: 10ug The CD45RA (G65226-1-5C) by Proteintech is a Monoclonal antibody targeting CD45RA in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65226-1-5C targets CD45RA in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information CD45, also known as protein tyrosine phosphatase, receptor type C, is a type I transmembrane protein expressed on the surface of all haematopoietic cells with the exception of erythrocytes and platelets (PMID: 3489673; 28615666). CD45 is a pan-haematopoietic cell marker and has been shown to be essential for T- and B-cell activation and signalling (PMID: 9429890; 16378097). CD45 exists as multiple isoforms due to alternative splicing of three exons (4, 5, and 6, designated A, B, and C) in the extracellular domain (PMID: 12414720). CD45RA is expressed on naïve T cells, B cells, and monocytes (PMID: 1830500; 14687231). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Human T lymphocytes Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD45RA (F8-11-13) Calculated Molecular Weight: 1304 aa, 147 kDa GenBank Accession Number: BC014239 Gene Symbol: CD45 Gene ID (NCBI): 5788 ENSEMBL Gene ID: ENSG00000081237 RRID: AB_3673937 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTTACTCCTCCAGGTTCCCATATAAGAAA Barcode Sequence: TTACTCCTCCAGGTT Form: Liquid UNIPROT ID: P08575 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.