Iright
BRAND / VENDOR: Proteintech

Proteintech, G65247-1-5C, MultiPro® 5CFLX Anti-Human CD226 (11A8)

CATALOG NUMBER: G65247-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The CD226 (G65247-1-5C) by Proteintech is a Monoclonal antibody targeting CD226 in Single Cell (Intra) applications with reactivity to Human samples G65247-1-5C targets CD226 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information CD226 (DNAM-1) is a ~65 kDa glycoprotein expressed on the surface of NK cells, platelets, monocytes and a subset of T cells. It is a member of the Ig-superfamily containing 2 Ig-like domains of the V-set. CD226 mediates cellular adhesion of platelets and megakaryocytic cells to vascular endothelial cells. The protein also plays a role in megakaryocytic cell maturation. Interactions of CD226 and its ligands, CD155 and CD112, induce NK and T cell-mediated cytotoxicity and cytokine secretion (PMID: 15039383). Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Human NK Cells Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD226 (11A8) Calculated Molecular Weight: 336 aa, 39 kDa GenBank Accession Number: BC074787 Gene Symbol: CD226 Gene ID (NCBI): 10666 ENSEMBL Gene ID: ENSG00000150637 RRID: AB_3673938 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGATTACTTATACGGAACCCATATAAGAAA Barcode Sequence: ATTACTTATACGGAA Form: Liquid UNIPROT ID: Q15762 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924