Iright
BRAND / VENDOR: Proteintech

Proteintech, G65253-1-5C, MultiPro® 5CFLX Anti-Human CD64 (10.1)

CATALOG NUMBER: G65253-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The CD64 (G65253-1-5C) by Proteintech is a Monoclonal antibody targeting CD64 in Single Cell (Intra), Single Cell applications with reactivity to Human samples G65253-1-5C targets CD64 in Single Cell (Intra), Single Cell applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Positive Single Cell detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test SINGLE CELL: <0.5ug/test Background Information Fcγ receptor comprise a multigene family of integral membrane glycoproteins that exhibit complex activation or inhibitory effects on cell functions after aggregation by complexed immunoglobulin G (IgG) (PMID: 17005690 ). CD64, also known as FcγRIA, is a high-affinity receptor for the Fc region of IgG. It is expressed by monocytes/macrophages, activated neutrophils, dendritic cells, and early myeloid cells (PMID: 23293080; 19642859; 7680917). CD64 functions in both innate and adaptive immune responses. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1, kappa Class: Oligo Conjugate Type: Monoclonal Immunogen: Human rheumatoid synovial fluid cells and fibronectin-purified monocytes. Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human CD64 (10.1) Calculated Molecular Weight: 374 aa, 43 kDa GenBank Accession Number: BC032634 Gene Symbol: FCGR1A Gene ID (NCBI): 2209 ENSEMBL Gene ID: ENSG00000150337 RRID: AB_3673939 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCCATCGCCAGCGCGGCCCATATAAGAAA Barcode Sequence: CCATCGCCAGCGCGG Form: Liquid UNIPROT ID: P12314 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924