Iright
BRAND / VENDOR: Proteintech

Proteintech, G66721-1-5C, MultiPro® 5CFLX Anti-Human SYK (4C4A12)

CATALOG NUMBER: G66721-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The SYK (G66721-1-5C) by Proteintech is a Monoclonal antibody targeting SYK in Single Cell (Intra) applications with reactivity to Human samples G66721-1-5C targets SYK in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information SYK(spleen tyrosine kinase) is a key regulator of signal transduction events,apoptosis and orderly cell cycle progression in B-lineage lymphoid cells. Although SYK has not been linked to a human disease, defective expression of the closely related T-cell tyrosine kinase ZAP-70 has been associated with severe combined immunodeficiency(PMID:11494125). This protein has 2 isoforms produced by alternative splicing. SYK also promotes liver fibrosis by activation of hepatic stellate cells and acts as a biomarker for human hepatocellular carcinoma. (PMID: 29537660) Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2b Class: Oligo Conjugate Type: Monoclonal Immunogen: CatNo: Ag17654 Product name: Recombinant human SYK protein Source: e coli. -derived, PET28a Tag: 6*His Domain: 239-427 aa of BC001645 Sequence: QLVEHYSYKADGLLRVLTVPCQKIGTQGNVNFGGRPQLPGSHPATWSAGGIISRIKSYSFPKPGHRKSSPAQGNRQESTVSFNPYEPELAPWAADKGPQREALPMDTEVYESPYADPEEIRPKEVYLDRKLLTLEDKELGSGNFGTVKKGYYQMKKVVKTVAVKILKNEANDPALKDELLAEANVMQQL Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human SYK (4C4A12) Calculated Molecular Weight: 635 aa, 72 kDa GenBank Accession Number: BC001645 Gene Symbol: SYK Gene ID (NCBI): 6850 ENSEMBL Gene ID: ENSG00000165025 RRID: AB_3673959 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGTGATGCGCTGACGCCCATATAAGAAA Barcode Sequence: CGTGATGCGCTGACG Form: Liquid UNIPROT ID: P43405 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924