Iright
BRAND / VENDOR: Proteintech

Proteintech, G66920-1-5C, MultiPro® 5CFLX Anti-Human NFKB2 (6A10E9)

CATALOG NUMBER: G66920-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The NFKB2 (G66920-1-5C) by Proteintech is a Monoclonal antibody targeting NFKB2 in Single Cell (Intra) applications with reactivity to Human samples G66920-1-5C targets NFKB2 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information NF-kappa-B is a pleiotropic transcription factor which is present in almost all cell types and is involved in many biological processed such as inflammation, immunity, differentiation, cell growth, tumorigenesis and apoptosis. NF-kappa-B is a homo- or heterodimeric complex formed by the Rel-like domain-containing proteins RELA/p65, RELB, NFKB1/p105, NFKB1/p50, REL and NFKB2/p52. NFKB2 appears to have dual functions such as cytoplasmic retention of attached NF-kappa-B proteins by p100 and generation of p52 by a cotranslational processing. The proteasome-mediated process ensures the production of both p52 and p100 and preserves their independent function. P52 binds to the kappa-B consensus sequence 5'-GGRNNYYCC-3', located in the enhancer region of genes involved in immune response and acute phase reactions. P52 and p100 are respectively the minor and major form; the processing of p100 being relatively poor. Isoform p49 is a subunit of the NF-kappa-B protein complex, which stimulates the HIV enhancer in synergy with p65. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG1 Class: Oligo Conjugate Type: Monoclonal Immunogen: CatNo: Ag28543 Product name: Recombinant human NFKB2 protein Source: e coli. -derived, PET28a Tag: 6*His Domain: 600-899 aa of BC002844 Sequence: GLYPVHLAVRARSPECLDLLVDSGAEVEATERQGGRTALHLATEMEELGLVTHLVTKLRANVNARTFAGNTPLHLAAGLGYPTLTRLLLKAGADIHAENEEPLCPLPSPPTSDSDSDSEGPEKDTRSSFRGHTPLDLTCSTKVKTLLLNAAQNTMEPPLTPPSPAGPGLSLGDTALQNLEQLLDGPEAQGSWAELAERLGLRSLVDTYRQTTSPSGSLLRSYELAGGDLAGLLEALSDMGLEEGVRLLRGPETRDKLPSTEVKEDSAYGSQSVEQEAEKLGPPPEPPGGLCHGHPQPQVH Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human NFKB2 (6A10E9) Calculated Molecular Weight: 97 kDa GenBank Accession Number: BC002844 Gene Symbol: NFKB2 Gene ID (NCBI): 4791 ENSEMBL Gene ID: ENSG00000077150 RRID: AB_3673962 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCGAAGTGTGACATCTCCCATATAAGAAA Barcode Sequence: CGAAGTGTGACATCT Form: Liquid UNIPROT ID: Q00653 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924