Iright
BRAND / VENDOR: Proteintech

Proteintech, G67589-1-5C, MultiPro® 5CFLX Anti-Human Drebrin (1A12H1)

CATALOG NUMBER: G67589-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The Drebrin (G67589-1-5C) by Proteintech is a Monoclonal antibody targeting Drebrin in Single Cell (Intra) applications with reactivity to Human samples G67589-1-5C targets Drebrin in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information Drebrin (DBN1) is an actin binding and stabilizing protein with roles in endocytosis, formation of dendrite spines in neurons and coordinating cell-cell synapses in immune cells. Preferentially expressed in the brain, it is highly localized in dendritic spines and regulates spine shapes. It has two isoforms that are splice variants, with drebrin A being expressed in neural cells, and drebrin E is present in several other cell types. Recently it has been reported that circulating DBN1 levels correlated with retinal nerve fiber layer defect and may reflect the severity of retinal ganglion cells injury in glaucoma patients. Specification Tested Reactivity: Human Host / Isotype: Mouse / IgG2a Class: Oligo Conjugate Type: Monoclonal Immunogen: CatNo: Ag22635 Product name: Recombinant human Drebrin protein Source: e coli. -derived, PET28a Tag: 6*His Domain: 1-353 aa of BC007567 Sequence: MAGVSFSGHRLELLAAYEEVIREESAADWALYTYEDGSDDLKLAASGEGGLQELSGHFENQKVMYGFCSVKDSQAALPKYVLINWVGEDVPDARKCACASHVAKVAEFFQGVDVIVNASSVEDIDAGAIGQRLSNGLARLSSPVLHRLRLREDENAEPVGTTYQKTDAAVEMKRINREQFWEQAKKEEELRKEEERKKALDERLRFEQERMEQERQEQEERERRYREREQQIEEHRRKQQTLEAEEAKRRLKEQSIFGDHRDEEEETHMKKSESEVEEAAAIIAQRPDNPREFFKQQERVASASAGSCDVPSPFNHRPGSHLDSHRRMAPTPIPTRSPSDSSTASTPVAEQIE Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human Drebrin (1A12H1) GenBank Accession Number: BC007567 Gene Symbol: Drebrin Gene ID (NCBI): 1627 ENSEMBL Gene ID: ENSG00000113758 RRID: AB_3673966 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGTGTACTGAGATAGGCCCCATATAAGAAA Barcode Sequence: TGTACTGAGATAGGC Form: Liquid UNIPROT ID: Q16643 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924