Iright
BRAND / VENDOR: Proteintech

Proteintech, G81478-1-5C, MultiPro® 5CFLX Anti-Human ENO1 (2C20)

CATALOG NUMBER: G81478-1-5C
السعر العادي$0.99
/
  • In stock, ready to ship

  • الطلب مؤجل، سيتم الشحن قريباً

This site is protected by hCaptcha and the hCaptcha Privacy Policy and Terms of Service apply.

Product Description
Size: 10ug The ENO1 (G81478-1-5C) by Proteintech is a Recombinant antibody targeting ENO1 in Single Cell (Intra) applications with reactivity to Human samples G81478-1-5C targets ENO1 in Single Cell (Intra) applications and shows reactivity with Human samples. Tested Applications Positive Single Cell (Intra) detected in: 10x Genomics Gene Expression Flex with Feature Barcodes and Multiplexing product. Recommended dilution SINGLE CELL (INTRA): <0.5ug/test Background Information ENO1, also named as NNE, ENO1L1, MBPB1, MPB1 and MBP1, belongs to the enolase family. ENO1 is a metabolic enzyme involved in the synthesis of pyruvate. It also acts as a plasminogen receptor and mediates the activation of plasmin and extracellular matrix degradation. In tumor cells, ENO1 is up-regulated and supports the Warburg effect; it is expressed at the cell surface, where it promotes cancer invasion, and is subjected to a specific array of post-translational modifications, namely acetylation, methylation and phosphorylation. ENO1 overexpression and post-translational modifications could be of diagnostic and prognostic value in many cancer types. (PMID: 27814656). This antibody is specific to ENO1 and has no cross-reaction with ENO2 and ENO3. Specification Tested Reactivity: Human Host / Isotype: Rabbit / IgG Class: Oligo Conjugate Type: Recombinant Immunogen: CatNo: Ag1692 Product name: Recombinant human ENO1 protein Source: e coli. -derived, PGEX-4T Tag: GST Domain: 2-434 aa of BC015641 Sequence: SILKIHAREIFDSRGNPTVEVDLFTSKGLFRAAVPSGASTGIYEALELRDNDKTRYMGKGVSKAVEHINKTIAPALVSKKLNVTEQEKIDKLMIEMDGTENKSKFGANAILGVSLAVCKAGAVEKGVPLYRHIADLAGNSEVILPVPAFNVINGGSHAGNKLAMQEFMILPVGAANFREAMRIGAEVYHNLKNVIKEKYGKDATNVGDEGGFAPNILENKEGLELLKTAIGKAGYTDKVVIGMDVAASEFFRSGKYDLDFKSPDDPSRYISPDQLADLYKSFIKDYPVVSIEDPFDQDDWGAWQKFTASAGIQVVGDDLTVTNPKRIAKAVNEKSCNCLLLKVNQIGSVTESLQACKLAQANGWGVMVSHRSGETEDTFIADLVVGLCTGQIKTGAPCRSERLAKYNQLLRIEEELGSKAKFAGRNFRNPLAK Predict reactive species Full Name: MultiPro® 5CFLX Anti-Human ENO1 (2C20) Calculated Molecular Weight: 47 kDa GenBank Accession Number: BC015641 Gene Symbol: ENO1 Gene ID (NCBI): 2023 ENSEMBL Gene ID: ENSG00000074800 RRID: AB_3673978 Conjugate: 5CFLX Full Oligo Sequence: CGGAGATGTGTATAAGAGACAGCTTGTTACATAGACTCCCATATAAGAAA Barcode Sequence: CTTGTTACATAGACT Form: Liquid UNIPROT ID: P06733 Storage Buffer: PBS with 1mM EDTA and 0.09% sodium azide , pH 7.3. Storage Conditions: 2-8°C Stable for one year after shipment.

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924