Product Description
Reactivity: Human (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Regulatory Status: RUO
Description: Description The BD® OMICS-One Innate Protein Panel consists of 4 single tubes, 2 tubes of NK-Cell Protein Panel (1 test/tube) containing 30 different specificities against major NK-Cell markers and 2 tubes of APC/Myeloid-Cell Protein Panel (1 test/tube) containing 30 different specificities against major APC/Myeloid-Cell markers. Designed and optimized to work on the BD Rhapsody™ System, the Innate Protein Panel is tested to work seamlessly alongside the BD Rhapsody™ Whole Transcriptome Analysis (WTA) Assay, Targeted mRNA Assay, BD® Single-Cell Multiplexing Kit (SMK), BD® Intracellular CITE-seq (IC-AbSeq) Assay, and BD Rhapsody™ TCR/BCR Next Multiomic Assay for human. The individual antibodies were each conjugated to an oligonucleotide that contains a specific antibody barcode sequence flanked by a polyA tail on the 3' end and a common PCR handle (PCR primer binding site) on the 5' end. All AbSeq barcode sequences were generated in-silico with minimal sequence similarity to the human genomes, have low predicted secondary structure, and have high Hamming distance within the BD antibody-oligo portfolio, to allow for sequencing error correction and unique mapping. The polyA tail of the oligonucleotide allows the barcode sequence to be captured by BD Rhapsody™ Enhanced Cell Capture Beads. The 5' PCR handle allows for efficient library generation for various sequencing platforms. Each individual antibody exists at an optimal concentration within the 58-plex panel to enable superior target and population resolution. The Innate Protein Panel is designed with SMART technology. SMART technology helps lower sequencing cost while increasing data resolution by attenuating antibodies that target high-expressing primary markers and allowing reallocation of sequencing reads to markers expressed at lower levels. With SMART technology, markers low in expression can be quantified without having to do deeper sequencing and incurring high sequencing cost. There are four specificities attenuated in the Innate Protein Panel, CD2 and CD31, CD45 and HLA-DR.
Preparation And Storage: Store at 2-8°C and protected from prolonged exposure to light. Do not freeze.
Recommended Assay Procedures: This reagent is provided lyophilized in a pre-titrated format. Each test can stain up to 2 million cells. 1. Remove one tube of BD® OMICS-One NK-Cell Protein Panel and one tube of BD® OMICS-One APC/Myeloid-Cell Protein Panel from foil bags and bring up to room temperature for 5 minutes. 2. Make sure both pellets are located at the bottom of the tubes. If not, briefly centrifuge to collect the contents at the tube bottom. 3. For each tube, add 35 µL of nuclease-free water to the bottom of the tube and allow antibodies to reconstitute for 5 minutes at room temperature. 4. Place the reconstituted antibodies on ice until the cells are ready for staining. Note: Reconstitute antibody immediately before cell staining. Prolonged incubation of reconstituted antibody may increase the non-specific background. 5. For BD® AbSeq Ab-Oligo drop-in of 42 plex or lower, prepare the BD® AbSeq labeling MasterMix in 1.5-mL LoBind tube on ice. Note: For drop-in with more than 42 plex, reach out to technical support for calculation. If sequential labeling with Sample Tags or no Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component 1 sample (µL) 1 sample + 2 samples + 30% overage (µL) 30% overage (µL) Per BD® AbSeq Ab-Oligo 2.0 2.6 5.2 Total of BD® AbSeq Ab-Oligo 2.0 × N* 2.6 × N 5.2 × N FBS † (catalog number 554656) 105 – (2.0 x N) 137 – (2.6 x N) 273 – (5.2 x N) Total 105 137 273 If co-labeling with Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as specified as follows: ____________________________________________________________________________________________ Component 1 sample (µL) 1 sample + 2 samples + 30% overage (µL) 30% overage (µL) Per BD® AbSeq Ab-Oligo 2.0 2.6 5.2 Total of BD® AbSeq Ab-Oligo 2.0 × N* 2.6 × N 5.2 × N FBS † (catalog number 554656) 85 – (2.0 × N) 111 – (2.6 × N) 221 – (5.2 × N) Total 85 111 221 * N = number of drop-in antibodies. N = 0 if there are no drop-in antibodies. † FBS = BD Pharmingen™ Stain Buffer. 6. Pipet-mix the BD® AbSeq labeling MasterMix for drop-ins. Briefly centrifuge to collect the contents at the bottom, and place back on ice. 7. For sequential labeling with Sample Tags or no Sample Tags, for each sample, combine the two tubes containing 35 μL reconstituted NK-Cell Protein Panel solution and 35 μL reconstituted APC/Myeloid-Cell Protein Panel solution. Then add 105 μL BD® AbSeq labeling MasterMix of drop-ins to the tube containing 70 μL reconstituted NK-Cell and APC/Myeloid-Cell Protein Panel solution to make a total volume of 175 μL. For co-labeling with Sample Tags, for each sample, combine the two tubes containing 35 μL reconstituted NK-Cell and 35 μL reconstituted APC/Myeloid-Cell Protein Panel solution. Then add 85 μL BD® AbSeq labeling MasterMix of drop-ins and 20 μL Sample Tag to the tube containing total 70μL reconstituted NK-Cell and APC/Myeloid-Cell Protein Panel solution to make a total volume of 175 μL 8. Pipet-mix the mixture, briefly centrifuge to collect the contents at the tube bottom, and place back on ice. 9. Centrifuge cells at 400 × g for 5 minutes. If Fc Block is used, proceed to step 10. If Fc Block is not used, skip to step 11. 10. (Optional) For samples containing myeloid and B lymphocytes, BD Biosciences recommends blocking nonspecific Fc Receptor–mediated false-positive signals with Human BD Fc Block (catalog number 564220) a. To perform blocking, pipet the Fc Block MasterMix into a new 1.5-mL LoBind tube on ice: _________________________________________________________________________________ Component 1 sample (µL)* 1 sample + 20% overage (µL) FBS† (catalog number 554656) 20.0 24.0 Fc Block‡ (catalog number 564220) 5.0 6.0 Total 25.0 30.0 * Sufficient for up to 1 million cells. To block more cells, adjust the volume. † FBS = BD Pharmingen™ Stain Buffer. ‡ Fc Block = BD Pharmingen™ Human BD Fc Block. b. Pipet-mix the Fc Block MasterMix and briefly centrifuge. Place on ice. c. Remove the supernatant from the cells without disturbing the pellet. d. Resuspend the cells in 25 μL of Fc Block MasterMix. e. Incubate the cells at room temperature (15°C to 25°C) for 10 minutes. f. Add 175 μL of BD® AbSeq labeling MasterMix from Step 8 into the cell suspension. Pipet-mix and proceed to Step 12. 11. Remove the supernatant from the cells without disturbing the pellet. Add 25 μL Stain Buffer (FBS) to the 175 μL of BD® AbSeq labeling MasterMix from Step 8 to make a total volume of 200 μL. Resuspend the cell pellet in 200 μL total volume. Pipet-mix. 12. Transfer the cells with BD® AbSeq labeling MasterMix into a new 5-mL polystyrene Falcon tube. 13. Stain the cells on ice for 30 minutes. 14. Add 3-4 mL Stain Buffer (FBS) to labelled cells and pipet-mix. 15. Centrifuge at 400 × g for 5 minutes. 16. Uncap the tube and invert to decant supernatant into biohazardous waste. Keep the tube inverted and gently blot on a lint-free wiper to remove residual supernatant from tube rim. 17. Repeat steps 14–16 twice more for a total of three washes. 18. Resuspend the final washed cell pellet in 620 µL cold Sample Buffer from the BD Rhapsody™ Enhanced Cartridge Reagent V3 (catalog number 667052) and proceed to single cell capture with on-cartridge washing described in substeps a–c. Refer to the BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252) or BD Rhapsody™ HT Xpress System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24253) for additional details. Note: Perform on-cartridge washing after cell settling (8-minute incubation) as described in the following sub-steps. a. At the protocol section of "Loading cells in BD Rhapsody™ 8-Lane Cartridge", after cell load, incubate the cartridge in the dark at room temperature for 8 minutes. b. P lace the cartridge on the BD Rhapsody™ HT Xpress and perform the On-Cartridge Wash steps as follows: _____________________________________________________________ Material to load Volume (µL) 1 lane Pipette Mode Air 380 Prime/Wash Cold Sample Buffer 380 Prime/Wash Air 380 Prime/Wash Cold Sample Buffer 380 Prime/Wash c. (Optional) Perform the scanner step: Cell Load Scan, if using BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252). No need for 8-minute delay before scanning. Warning: All biological specimens and materials are considered biohazardous. Handle as if capable of transmitting infection and dispose using proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves. List of all 30 Human AbSeq specificities included in the BD ® OMICS-One NK-Cell panel: ______________________________________________________________________________ Specificity Clone Oligo ID BD® AbSeq Barcode Sequence___________ CD11b* M1/70 AHS0005 ATCGTTATTCGTTGTAGTTCGCCCGGTTTGAGTAGT CD56 NCAM16.2 AHS0019 AGAGGTTGAGTCGTAATAATAATCGGAAGGCGTTGG CD38 HIT2 AHS0022 GTCAACGATGGGTAGCGGTAGAAATAACGGAACTGG CD27 M-271 AHS0025 TGTCCGGTTTAGCGAATTGGGTTGAGTCACGTAGGT CD2 RPA-2.10 AHS0029 AAACGTAGATTAGAGCCGGGTATGTCGCAACTGATT CD16* 3G8 AHS0053 TAAATCTAATCGCGGTAACATAACGGTGGGTAAGGT CD184 (CXCR4) 12G5 AHS0060 CAGTGTTTAGAGCGGGTTGCATATGTCGTTTAGAGG CD49d 9F10 AHS0063 TAGGGTGACTTAGCGATTGATGCGTATGTTTGGGCG CD314 (NKG2D) 1D11 AHS0065 TTGAAATGCGATGAGACGTAGAGCGATGTAGGTAGC CD335 (NKP46) 9E2/NKP46 AHS0068 CAATTTGTTCGCGTTTAGTAGTCGTCGTCTTATGGG CD54 HA58 AHS0076 AAGAGAATATATGCGTGCGTTGTTAAGGGAATGCGT CD226 DX11 AHS0079 GAGTTTATGATTCGTTTCTTCGGTAGTTCGTCGCTT CD94 HP-3D9 AHS0085 GAGGTTAGGATAGGTGTACGGGTCGAGTTGAATTCT CD336 (NKP44) p44-8 AHS0090 AATGCAAACGATATCACGAAGGGTAGTACACGACGG CD49a SR84 AHS0101 ATGACACGAATGCGACGAGAGGCGAAATAGGTTGGT CX3CR1 2A9-1 AHS0125 GGGTTCACGAGGTTTAAAGCGGTAGTATAGGATGCC CD122 Mik-β3 AHS0146 TTAAAGAGATTCGTGGGTATTGGCGCAGTCATTCCT CD140b (PDGFR) 28D4 AHS0151 GACAACATTTAGGACGTGACGAGAGAGTATAGCTTC CD248 B1/35 AHS0156 ATCACTTATTTCGTTTGGAGGGTTCGTAGGCGTTGC CD63 H5C6 AHS0157 TGCAGCGTTAGGACCAAGCGTTTACCGTAGAATATT CD140a α-R1 AHS0160 TTACTGACTTTCGGACGTTGGTTACTTAGGGTTATG CD31 (PECAM1) WM59 AHS0170 CTAAGGGACGTAATTGAGTTTCGGTGATCGCAGTTT CD96 6F9 AHS0194 CTAATGTAAGAGCGGACGTTTGGGCACTATATGTTT CD161 (KLRB1) HP-3G10 AHS0205 TTTAGGACGATTAGTTGTGCGGCATAGGAGGTGTTC CD158b (KIR) DX27 AHS0209 CGTAGGAGGATTTCGTCGATGGGTTTGTTAGCGTTC CD158e1 DX9 AHS0211 AGGTTCATTGCGGCATTAGGCGTCATATAGTAGGTG CD337/NKp30 P30-15 AHS0213 GGTAACTGACATGACGGAGCGATAATTTCTGGCGGT CD3 UCHT1 AHS0231 AGCTAGGTGTTATCGGCAAGTTGTACGGTGAAGTCG CD329 (Siglec-9) E10-286 AHS0239 CGGGCGCGAAGATAGGATAATAGGTAACGTCAAATG CD106 51-10C9 AHS0251 TCTGATTTAGCGGGTGGACGTATTATAGTGATTGGC_ List of all 30 Human AbSeq specificities included in the BD® OMICS-One APC/Myeloid-Cell panel: ______________________________________________________________________________ Specificity Clone Oligo ID BD® AbSeq Barcode Sequence___________ CD103 BER-ACT8 AHS0001 AAATAGTATCGAGCGTAGTTAAGTTGCGTAGCCGTT CD274 (PD-L1) MIH1 AHS0004 ATCGTAAGGCTCGTGGTTCGTAAGTAAGTTCGTATC CD11b* M1/70 AHS0005 ATCGTTATTCGTTGTAGTTCGCCCGGTTTGAGTAGT CD123 7G3 AHS0020 ACAGTTTAGTAGGACGTGAGGTATCGCGAGAATGCC HLA-DR G46-6 AHS0035 TGTTGGTTATTCGTTAGTGCATCCGTTTGGGCGTGG CD14 MPHIP9 AHS0037 TGGCCCGTGGTAGCGCAATGTGAGATCGTAATAAGT CD45 HI30 AHS0040 GTGCGAAATGGCGGAATGTTATCTGCGAATGTAGTC CD33 WM53 AHS0044 GTGTTAGTGATTTGATAGGACGCGTTACGAGAGATT CD80 L307.4 AHS0046 GAGGGTAACGGGTGTCCAAATATCGGCTGTGTAAGT CD16* 3G8 AHS0053 TAAATCTAATCGCGGTAACATAACGGTGGGTAAGGT CD64 10.1 AHS0055 TTGTGCGGCGTAGTATGGTTATCTCGAGTGAAAGTC CD11c B-LY6 AHS0056 ATGCGTTGCGAGAGATATGCGTAGGTTGCTGATTGG CD163 GHI/61 AHS0062 TATTATGTGCGAACTATGGTATCCGTATTGAGGGCT CD195 (CCR5) 2D7/CCR5 AHS0070 ATGGTTTAGTCGTACGTGGGTTTAGATTGGCGGTGC CD206 19.2 AHS0072 GCTGGTTATCGTTTGAGAGTCGGTATGGAATGCGGT CD32 FLI8.26 AHS0073 GGTTGTAGGTGCGGAATATAAGCGTCGTTGAGGTGT CD273 MIH18 AHS0075 TGAGTAACCGTATGTAATCCGTAATCGTAGAAGCGC CD141 1A4 AHS0083 TGGAAGTAAGTATGGGTCGGCGTAAATTGTGCGTGT CD1c F10/21A3 AHS0088 ATAGATTACATTCGTTTAGCGTTGGGTTCGGTCCGT CD40 5C3 AHS0117 GGTGTAATTGGGCTAGAACGTATATGCGGTAAGGCG FCeR1a AER-37 AHS0129 GATATGGCGTGATGGTAGGTTCGGTTTAAGTTAGCG CD169 7-239 AHS0133 CATTAAGCACGAAGGGTATAGGTAGGAACGGTTGGC CD36 IVC7 AHS0135 AATTGTAGTAGTCCGGTGTATGTAGAGTAGGCGTTT CD115 (CSF1R) 9-4D2-1E4 AHS0136 CTGGTGGCGGCGAATTTGGTTACGACATATAGGGTT CD162 KPL-1 AHS0139 CCAGATAGGCGATAGTGTTTAGGAGCGATTAGTGTG CD85K ZM3.8 AHS0179 AGTAGTCGTAGTTGGCGTGAATTGGGCTTATATCTG VISTA MIH65.RMAB AHS0187 ATCAGGGAATCTCGGTAAGTTAAACGTGTATAGTGC CD15 W6D3 AHS0196 ATAGGCATGGACGACGTAGATAATAAGTGGCGGGTT CD192 (CCR2) LS132.1D9 AHS0208 CATGAGTGAGGCGATATAGTGAGCGGTTTGTAGATT CD116 Hgmcsfr1-M1 AHS0238 CTTAGTTGTAGGATCGAGAGTAGGTGTGCATTGCGT_ * NK-Cell and APC/Myeloid-Cell Protein Panels contain the same CD11b and CD16 antibody.
Product Notices: This reagent is provided lyophilized in a pre-titrated format. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots. Go to https://www.bdbiosciences.com/en-us/resources/protocols/single-cell-multiomics for technical protocols. Go to https://abseq-ref-gen.genomics.bd.com/to access AbSeq reference files in FASTA format for bioinformatics analyses. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Source of all serum proteins is from USDA inspected abattoirs located in the United States. For U.S. patents that may apply, see bd.com/patents. Read and understand the safety data sheets (SDSs) before handling chemicals.To obtain SDSs, go to regdocs.bd.com or contact BD Biosciences technical support at scomix@bd.com.
Tables: Description: Quantity/Size: Quantity/Size Part Number: Part Number EntrezGene ID: EntrezGene ID
Description: Quantity/Size: 1.0 Part Number: N/A EntrezGene ID: N/A
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmtaion.
3. Minimum order value of $1,000 USD required.
4. 100% prepayment required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924