Product Description
Reactivity: Human (Tested in Development)
Application: Single Cell 3' Sequencing (Qualified)
Regulatory Status: RUO
Storage Buffer: Lyophilized powder containing BSA and ≤ 0.25% sodium azide.
Description: Description The BD® OMICS-One Tumor Protein Panel consists of 30 different specificities against major tumor markers in a single tube. Designed and optimized to work on the BD Rhapsody™ System, the Tumor Protein Panel is tested to work seamlessly alongside the BD Rhapsody™ Whole Transcriptome Analysis (WTA) Assay, Targeted mRNA Assay, BD® Single-Cell Multiplexing Kit (SMK), BD® Intracellular CITE-seq (IC-AbSeq) Assay, and BD Rhapsody™ TCR/BCR Next Multiomic Assay for human. The individual antibodies were each conjugated to an oligonucleotide that contains a specific antibody barcode sequence flanked by a polyA tail on the 3' end and a common PCR handle (PCR primer binding site) on the 5' end. All AbSeq barcode sequences were generated in-silico with minimal sequence similarity to the human genomes, have low predicted secondary structure, and have high Hamming distance within the BD antibody-oligo portfolio, to allow for sequencing error correction and unique mapping. The polyA tail of the oligonucleotide allows the barcode sequence to be captured by BD Rhapsody™ Enhanced Cell Capture Beads. The 5' PCR handle allows for efficient library generation for various sequencing platforms. Each individual antibody exists at an optimal concentration within the 30-plex to enable superior target and population resolution. The Tumor Protein Panel is designed with SMART technology. SMART technology helps lower sequencing cost while increasing data resolution by attenuating antibodies that target high-expressing primary markers and allowing reallocation of sequencing reads to markers expressed at lower levels. With SMART technology, markers low in expression can be quantified without having to do deeper sequencing and incurring high sequencing cost. The three specificities attenuated in the Tumor Protein Panel are CD44, HLA-ABC, and CD45.
Preparation And Storage: Preparation And Storage Store at 2-8°C and protected from prolonged exposure to light. Do not freeze.
Recommended Assay Procedures: Recommended Assay Procedures This reagent is provided lyophilized in a pre-titrated format. 1. Remove the BD® OMICS-One Tumor Protein Panel tube from the foil bag and bring up to room temperature for 5 minutes. 2. Make sure the pellet is located at the bottom of the tube. If not, briefly centrifuge to collect the contents at the tube bottom. 3. Add 35 µL of nuclease-free water to the bottom of the tube and allow antibodies to reconstitute for 5 minutes at room temperature. 4. Transfer the reconstituted antibodies on ice until the cells are ready for staining. Note: Reconstitute antibody immediately before cell staining. Prolonged incubation of reconstituted antibody may increase the non-specific background. 5. For BD® AbSeq Ab-Oligo drop-in of 60 plex or lower, prepare the BD® AbSeq labeling MasterMix in 1.5-mL LoBind tube on ice. Note: For drop-in with more than 60 plex, reach out to technical support for calculation. For sequential labeling with Sample Tags or no Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component 1 sample (µL) 1 sample + 2 samples + 30% overage (µL) 30% overage (µL) Per BD® AbSeq Ab-Oligo 2.0 2.6 5.2 Total of BD® AbSeq Ab-Oligo 2.0 × N* 2.6 × N 5.2 × N FBS † (catalog number 554656) 140 – (2.0 × N) 182 – (2.6 × N) 364 – (5.2 × N) Total 140 182 364 For co-labeling with Sample Tags, prepare BD® AbSeq labeling MasterMix for drop-ins as follows: ____________________________________________________________________________________________ Component 1 sample (µL) 1 sample + 2 samples + 30% overage (µL) 30% overage (µL) Per BD® AbSeq Ab-Oligo 2.0 2.6 5.2 Total of BD® AbSeq Ab-Oligo 2.0 × N* 2.6 × N 5.2 × N FBS † (catalog number 554656) 120 – (2.0 × N) 156 – (2.6 × N) 312 – (5.2 × N) Total 120 156 312 * N = number of drop-in antibodies. N = 0 if there are no drop-in antibodies. † FBS = BD Pharmingen™ Stain Buffer. 6. Pipet-mix the BD® AbSeq labeling MasterMix for drop-ins. Briefly centrifuge to collect the contents at the bottom, and place back on ice. 7. For sequential labeling with Sample Tags or no Sample Tags, for each sample, add 140 µL BD® AbSeq labeling MasterMix of drop-ins to the tube containing 35 µL reconstituted Tumor Protein Panel solution to make a total volume of 175 µL. For co-labeling with Sample Tags, for each sample, add 120 µL BD® AbSeq labeling MasterMix of drop-ins and 20 µL Sample Tag to the tube containing 35 µL reconstituted Tumor Protein Panel solution to make a total volume of 175 µL. 8. Pipet-mix the mixture, briefly centrifuge to collect the contents at the tube bottom, and place back on ice. 9. Centrifuge cells at 400 × g for 5 minutes. If Fc Block is used, proceed to step 10. Otherwise, skip to step 11. 10. (Optional) For samples containing myeloid and B lymphocytes, BD Biosciences recommends blocking nonspecific Fc Receptor–mediated false-positive signals with Human BD Fc Block (Cat. No. 564220). a. To perform blocking, pipet the Fc Block MasterMix into a new 1.5-mL LoBind tube on ice: _________________________________________________________________________________ Component 1 sample (µL)* 1 sample + 20% overage (µL) FBS† (catalog number 554656) 20.0 24.0 Fc Block‡ (catalog number 564220) 5.0 6.0 Total 25.0 30.0 * Sufficient for up to 1 million cells. To block more cells, adjust the volume. † FBS = BD Pharmingen™ Stain Buffer. ‡ Fc Block = BD Pharmingen™ Human BD Fc Block. b. Pipet-mix the Fc Block MasterMix and briefly centrifuge. Place on ice. c. Remove the supernatant from the cells without disturbing the pellet. d. Resuspend the cells in 25 µL of Fc Block MasterMix. e. Incubate the cells at room temperature (15°C to 25°C) for 10 minutes. f. Add 175 µL of BD® AbSeq labeling MasterMix from Step 8 into the cell suspension. Pipet-mix and proceed to Step 12. 11. Remove the supernatant from the cells without disturbing the pellet. Add 25 µL Stain Buffer (FBS) to the 175 µL of BD® AbSeq labeling MasterMix from Step 8 to make a total volume of 200 µL. Resuspend the cell pellet in 200 µL total volume. Pipet-mix. 12. Transfer the cells with BD® AbSeq labeling MasterMix into a new 5-mL polystyrene Falcon tube. 13. Stain the cells on ice for 30 minutes. 14. Add 3–4 mL Stain Buffer (FBS) to labelled cells and pipet-mix. 15. Centrifuge at 400 x g for 5 minutes. 16. Uncap the tube and invert to decant supernatant into biohazardous waste. Keep the tube inverted and gently blot on a lint-free wiper to remove residual supernatant from tube rim. 17. Repeat steps 14–16 twice more for a total of three washes. 18. Resuspend the final washed cell pellet in 620 µL cold Sample Buffer from the BD Rhapsody™ Enhanced Cartridge Reagent V3 (catalog number 667052) and proceed to single cell capture with on-cartridge washing described in substeps a–c. Refer to the BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252) or BD Rhapsody™ HT Xpress System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24253) for additional details. Note: Perform on-cartridge washing after cell settling (8-minute incubation) as follows: a. At the protocol section of "Loading cells in BD Rhapsody™ 8-Lane Cartridge", after cell load, incubate the cartridge in the dark at room temperature for 8 minutes. b. Place the cartridge on the BD Rhapsody™ HT Xpress and perform the following On-Cartridge Wash steps: _____________________________________________________________ Material to load Volume (µL) 1 lane Pipette Mode Air 380 Prime/Wash Cold Sample Buffer 380 Prime/Wash Air 380 Prime/Wash Cold Sample Buffer 380 Prime/Wash c. (Optional) Perform the scanner step: Cell Load Scan, if using BD Rhapsody™ HT Single-Cell Analysis System Single-Cell Capture and cDNA Synthesis Protocol (Doc ID 23-24252). No need for 8-minute delay before scanning. Warning: All biological specimens and materials are considered biohazardous. Handle as if capable of transmitting infection and dispose using proper precautions in accordance with federal, state, and local regulations. Never pipette by mouth. Wear suitable protective clothing, eyewear, and gloves. List of all 30 Human AbSeq specificities included in the BD® OMICS-One Tumor panel: _____________________________________________________________________________ Specificity Clone Oligo ID BD® AbSeq Barcode Sequence CD274 (PD-L1) MIH1 AHS0004 ATCGTAAGGCTCGTGGTTCGTAAGTAAGTTCGTATC CD279 (PD-1) EH12.1 AHS0014 ATGGTAGTATCACGACGTAGTAGGGTAATTGGCAGT CD45 HI30 AHS0040 GTGCGAAATGGCGGAATGTTATCTGCGAATGTAGTC CD324 (E-cad) 67A4 AHS0041 GATATGAATGGGTTGCGGTGTAAAGTCGTAATGGTT CD24 ML5 AHS0042 ACTTTGGGTTGAGCGCATGATTATTCGTGACACTTT CD90 5E10 AHS0045 GACTATATGTACGGTGTTAATTCGGGATCCTGCGCT CD34 581 AHS0061 TGGGTGTATTACGGTTAGTTTATGCGCGAAGGTGTT CD117 YB5.B8 AHS0064 GGATTAGTTGTCGTTATAGGGAGTGCGTTCTTAGCG HLA-A,B,C G46-2.6 AHS0066 GATATGCATGGCGAGTAGGTAGAACGAAGCTTAGGT CD54 HA58 AHS0076 AAGAGAATATATGCGTGCGTTGTTAAGGGAATGCGT CD29 MAR4 AHS0080 TGGTAAGGTGGTTGCGAGTAAGTAGCGGTGAGTTGT CD47 B6H12 AHS0087 TGTTAGGTTCGACGTATTATGTGTAGATCCGCAAGG CD326 (EpCam) EBA-1 AHS0089 TTGAGCGTAAAGTTGCGTCCGGTAATTGAGTTGCGT CD66 B1.1/CD66 AHS0094 GTCTGCGCAAGGTAAGCTAAGTAACGAAAGGGATCT CD133 W6B3C1 AHS0103 TTTGGTATTGGCACGGTTTGTAGCGAGTTGACGGTC CD26 M-A261 AHS0109 TGTAGGTTGCGCGGTTATTAGGGTATTATCGATCTG CD155 TX24 AHS0111 GCGGTGGATCGATGGGTATAGTTGGTAATTTGCGTC CD146 P1H12 AHS0127 AGGTTATTTAGGTGACGGTTGTATTGACGAGAGAGG C-MET 3D6 AHS0132 AGCGTGAGTTGTCGGTAGTTAATTATCGGAGAGTTT ITGRN BTA 7 FIB504 AHS0158 TTTCAGTTTGGTCGCAGTTAAGGTATCGTATGGGTC CD44 L178 AHS0167 GTGATTGATTAGGACAGTTCGTTGCTTAGTAGTGGG PECAM1 (CD31) WM59 AHS0170 CTAAGGGACGTAATTGAGTTTCGGTGATCGCAGTTT EphB2 2H9 AHS0176 TATTGCGGGTAGGATTTGTCTCGAAGCGTAGGTAGC Vista MIH65.RMAB AHS0187 ATCAGGGAATCTCGGTAAGTTAAACGTGTATAGTGC PDPLN LPMAB-17 AHS0192 TTTATGAGTATTACGTCTGTTGCGATTGTTGGCGGT NOTCH1 MHN1-519 AHS0214 CGTAGTAGGAGCGTGTTTCATCGGCATTATCGTTTG CD325 (n-Cad) 8C11 AHS0223 TAGGATGAGTTTCGTAAGTAAGGTAGTCGTATGGCT CD58 1C3 AHS0237 TTGGTGAGTATTGGTGCGTAGTATGCGGGATGTTTG EGFR EGFR.1 AHS0241 ATATGATTGATGCGGGTTAGCCTACAGATTCGAGTT CD227 (MUC1) HMFG2 AHS0247 AGTGCATGGTTAGTAGGTGTGAGTCGTTAGATATTC
Product Notices: Product Notices Please refer to www.bdbiosciences.com/us/s/resources for technical protocols. Source of all serum proteins is from USDA inspected abattoirs located in the United States. The production process underwent stringent testing and validation to assure that it generates a high-quality conjugate with consistent performance and specific binding activity. However, verification testing has not been performed on all conjugate lots. Please refer to http://regdocs.bd.com to access safety data sheets (SDS). For U.S. patents that may apply, see bd.com/patents. Caution: Sodium azide yields highly toxic hydrazoic acid under acidic conditions. Dilute azide compounds in running water before discarding to avoid accumulation of potentially explosive deposits in plumbing. Follow state and local guidelines when disposing of hazardous waste. Go to https://abseq-ref-gen.genomics.bd.com/to access AbSeq reference files in FASTA format for bioinformatics analyses. This reagent is provided lyophilized in a pre-titrated format.
Order Guidelines
1. Price & Stock Available on Request. Click to send email to: service@iright.com
2. Please DO NOT make payment before confirmtaion.
3. Minimum order value of $1,000 USD required.
4. 100% prepayment required.
Collaboration
Tony Tang
Email: Tony.Tang@iright.com
Mobile/WhatsApp/Wechat: +86-17717886924