BRAND / VENDOR: Thermo Fisher

Thermo Fisher, N56002, T7 Promoter Primer

CATALOG NUMBER: N56002

Precio habitual$0.99
/
Los gastos de envío se calculan en la pantalla de pagos.
  • quedan 99 artículos
  • Pedido pendiente, envío pronto

Este sitio está protegido por hCaptcha y se aplican la Política de privacidad de hCaptcha y los Términos del servicio.

Product Description

Thermo Fisher, N56002, T7 Promoter Primer Thermo Fisher Scientific offers primers for PCR amplification that complement many of the vectors currently available. The T7 Promoter Primer is recognized by T7 RNA polymerase and is commonly used to regulate gene expression of recombinant proteins. Subsequent recombinant proteins may be used for further downstream research applications.
T7 Promoter Primer features include:
• Desalted and purified by gel filtration
• Assayed for function by PCR amplification
• Provided in 2 μg quantityApplications
• Sanger sequencing
• PCR amplificationT7 Primer Sequence:5´- TAATACGACTCACTATAGGG- 3´For Use With (Application): PCR Amplification
Form: Lyophilized
Primer Length: 20-mer
Primer Sequence: 5 ́d[TAATACGACTCACTATAGGG]3 ́
Product Type: Primer
Purification Method: Gel-purified
Quantity: 2 μg
Shipping Condition: Room Temperature
Primer: T7
Promoter: T7
Unit Size: Each

Order Guidelines

1. Price & Stock Available on Request. 📧Click to send email to: service@iright.com

2. Please DO NOT make payment before confirmation.

3. Minimum order value of $1,000 USD required.

Collaboration

Tony Tang

📧Email: Tony.Tang@iright.com

📱Mobile/WhatsApp/Wechat: +86-17717886924